Directory AWTC/

Directory Created:
2000-11-23 11:41
Total Files:
6
Deleted Files:
20
Lines of Code:
1048

[root]/AWTC

Lines of Code

AWTC/ Lines of Code

Developers

Author Changes Lines of Code Lines per Change
Totals 382 (100.0%) 14528 (100.0%) 38.0
oldcode 24 (6.3%) 7173 (49.4%) 298.8
westram 349 (91.4%) 6988 (48.1%) 20.0
meierh 2 (0.5%) 210 (1.4%) 105.0
jobb 3 (0.8%) 154 (1.1%) 51.3
boehnel 2 (0.5%) 3 (0.0%) 1.5
baderk 1 (0.3%) 0 (0.0%) 0.0
artemov 1 (0.3%) 0 (0.0%) 0.0

Most Recent Commits

westram 2017-11-28 19:22 Rev.: 16766


* reintegrates 'gcc' into 'trunk'
- mostly cosmetics changes
* adds: log:branches/gcc@16655,16741:16743,16752:16765

5 lines of code changed in 2 files:

  • AWTC: AWTC_next_neighbours.cxx (+2 -3), AWTC_submission.cxx (+3 -6)
westram 2017-11-28 18:09 Rev.: 16763


* partial merge from 'gcc' into 'trunk'
- use {{{nullptr}}} in Cxx11 (with backward compatibility)
* adds: log:branches/gcc@16683:16740,16744:16746,16751

32 lines of code changed in 2 files:

  • AWTC: AWTC_next_neighbours.cxx (+29 -29), AWTC_submission.cxx (+3 -3)
westram 2017-10-03 18:26 Rev.: 16469


* reintegrates 'textedit' into 'trunk'
- fixes #586
* editor now always started asynchronously
* uses inotify to track file changes
- ~~also use inotify to track directory updates (in order to update file selections when needed)~~\\(./) by [16515] ff.; merged by [16551]
* adds: log:branches/textedit@16448:16468

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1)
westram 2017-09-23 14:03 Rev.: 16425


* reintegrates 'aci' into 'trunk'
- extends ACI language (implementing #707)
* boolean operators: {{{And}}},{{{Or}}},{{{Not}}}
* numeric comparison: {{{isAbove}}},{{{isBelow}}},{{{isEqual}}}
* floating point arithmetic: {{{fplus}}},{{{fminus}}},{{{fmult}}},{{{fdiv}}}
* misc: {{{round}}},{{{inRange}}},{{{isEmpty}}}
- enforce parameter checks in ACI function code
- case of commands completely ignored
* adds: log:branches/aci@16385,16391:16424

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1)
westram 2017-09-18 15:23 Rev.: 16374


* reintegrates 'aci' into 'trunk'
- refactored wide parts of ACI code (incl. SRT+REG)
* added more test
* ACI tracing
- more complete and readable
- automatically turned off when done with expression
* improved error messages (esp. diagnostics)
* documentation (updated, added missing)
* fixed a bunch of bugs (incl. SEGV and deadlock)
* ACI now runs inside execution environment
- ACI language may be extended with custom commands (implements #756)
* added ACI extension for group-batch-rename
* adds:
- log:branches/aci@16170:16373
- log:branches/addtest@16193:16316

20 lines of code changed in 3 files:

  • AWTC: AWTC_next_neighbours.cxx (+1 -1), AWTC_submission.cxx (+18 -12), Makefile (+1)
westram 2016-08-11 11:05 Rev.: 15176


* reintegrates 'fixres' into 'trunk'
- fixes #715
* adds: log:branches/fixres@15127:15175

4 lines of code changed in 2 files:

  • AWTC: AWTC_submission.cxx (+2 -2), Makefile (+2)
westram 2015-12-16 16:13 Rev.: 14622


* reintegrates 'ui' into 'trunk'
- implements #656
- adds instant update for
* next neighbour search
* branch analysis (mark functions)
* arb-phylo (filter setup)
* adds: log:branches/ui@14588:14621

33 lines of code changed in 3 files:

  • AWTC: AWTC_next_neighbours.cxx (+27 -9), Makefile (+1), awtc_next_neighbours.hxx (+5 -2)
westram 2015-11-17 14:54 Rev.: 14498


* globally add explicit casts (either long or double) for all numeric ellipse arguments of aisc_put, aisc_nput and aisc_create
- errors caused by just changing the type of a passed variable are far too subtle

2 lines of code changed in 1 file:

  • AWTC: AWTC_next_neighbours.cxx (+2 -2)
westram 2015-01-23 15:19 Rev.: 13443


* reintegrates 'vectorize' into 'trunk'
- adds vectorization check for gcc 4.9.x / NDEBUG compile
* adds:
- log:branches/vectorize@13428:13442

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1 -1)
westram 2014-05-13 09:31 Rev.: 12223


* fix: impossible to create a new submission form (name always fell back to 'default')
- caused by selectionlist-defaultfallback via option-menu

2 lines of code changed in 1 file:

  • AWTC: AWTC_submission.cxx (+2 -2)
westram 2014-05-13 09:24 Rev.: 12222


* use typed CBs

13 lines of code changed in 1 file:

  • AWTC: AWTC_submission.cxx (+13 -15)
westram 2014-05-13 09:16 Rev.: 12221


* replace magic awar names by defines

27 lines of code changed in 1 file:

  • AWTC: AWTC_submission.cxx (+27 -30)
westram 2014-05-12 15:22 Rev.: 12205


* inlined default param for create_option_menu

4 lines of code changed in 2 files:

  • AWTC: AWTC_next_neighbours.cxx (+3 -3), AWTC_submission.cxx (+1 -1)
westram 2014-05-12 12:38 Rev.: 12192


* do not use more than 1 parameter in calls to create_option_menu
- 2nd parameter 'label' is dominated by a previous call to label (use direct label calls instead)
- 3rd parameter 'mnemonic' is w/o function in motif and is superfluous in gtk anyway
* reset 'gone_tree_name'

5 lines of code changed in 2 files:

  • AWTC: AWTC_next_neighbours.cxx (+3 -3), AWTC_submission.cxx (+2 -1)
westram 2014-03-25 12:06 Rev.: 11889


- add missing comment to closing #endif of test-sections

1 lines of code changed in 1 file:

  • AWTC: AWTC_next_neighbours.cxx (+1 -1)
westram 2014-01-28 18:13 Rev.: 11512


* merge [11502,11504,11505] from 'dist' into 'trunk'
* adds:
- log:branches/dist@11502,11504:11505

3 lines of code changed in 2 files:

  • AWTC: AWTC_submission.cxx (+2 -3), awtc_submission.hxx (+1 -1)
westram 2014-01-10 20:16 Rev.: 11464


- un-dummy-fied transaction (renames only)

1 lines of code changed in 1 file:

  • AWTC: AWTC_submission.cxx (+1 -1)
westram 2013-11-03 15:42 Rev.: 11060


* reintegrates 'ptsfix' into 'trunk':
* adds:
- log:branches/ptsdump@8966:9000
- log:branches/ptsfix@8965:9012,9014:9017,9019:9023,9025:9046,9048:9089,9091:9114,9116:9132,9134:9139,9141:9145,9147:9151,9153:9158,9160:9379,9381:11059
- log:branches/ptsstartup@9160:9235,9237:9278,9280:9336,9339:9361,9363:9446
- log:branches/ptsundef@9061:9358

12 lines of code changed in 1 file:

  • AWTC: AWTC_next_neighbours.cxx (+12 -10)
westram 2013-11-02 17:41 Rev.: 11034


* depends for [11033]

2 lines of code changed in 1 file:

  • AWTC: Makefile (+2)
westram 2013-10-31 15:10 Rev.: 10996


* use cflags before cxxflags

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1 -1)
westram 2013-10-30 16:58 Rev.: 10974


* renamed include variables

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1 -1)
westram 2013-10-29 13:55 Rev.: 10956


* made A_CC and A_CXX consistent
- A_CXX previously contained cxxflags
- cxxflags are now passed down and used separately

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1 -1)
westram 2013-10-29 13:23 Rev.: 10955


- renamed
* ACC -> A_CC
* CPP -> A_CXX (misleading atm, since it contains c++flags)

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1 -1)
westram 2013-10-29 12:43 Rev.: 10954


- document mechanism used by ARB to export variables to submakefiles
- document most important variables

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1 -1)
westram 2013-10-21 14:16 Rev.: 10863


* replaced usage of untyped AW_POPUP_HELP

1 lines of code changed in 1 file:

  • AWTC: AWTC_submission.cxx (+1 -1)
westram 2013-09-09 16:36 Rev.: 10563


- include downcast.h from arbdbt.h
(this break C++11 compilation, i.e. gcc4.8 or newer)[[BR]]
amendment:
* also broke compilation on ubuntu 13.04 and with gcc 4.7.3 (due to nameclash with boost)

2 lines of code changed in 1 file:

  • AWTC: Makefile (+2)
westram 2013-07-04 16:49 Rev.: 10212


* depends for recent patches

6 lines of code changed in 1 file:

  • AWTC: Makefile (+6)
westram 2013-06-04 15:20 Rev.: 10113


* changed dynamic value-initializations into default-initializations
- i believe/know they were used with ignorance of [http://stackoverflow.com/questions/620137/do-the-parentheses-after-the-type-name-make-a-difference-with-new?answertab=active#tab-top ctor-behavior].

1 lines of code changed in 1 file:

  • AWTC: AWTC_next_neighbours.cxx (+1 -1)
westram 2013-05-13 20:09 Rev.: 10029


- misc error handling fixes

1 lines of code changed in 1 file:

  • AWTC: AWTC_submission.cxx (+1 -1)
westram 2013-02-13 13:24 Rev.: 9575


- effect of [9574] (comments only)

1 lines of code changed in 1 file:

  • AWTC: Makefile (+1 -1)
westram 2013-02-11 12:35 Rev.: 9533


* use explicit override
- rest

1 lines of code changed in 1 file:

  • AWTC: awtc_next_neighbours.hxx (+1 -1)
westram 2013-02-09 14:36 Rev.: 9522


- explicit override destructors of classes derived from virtual base classes
- skipped directories WINDOW and PROBE (should be done in branches gtk and ptsfix)

1 lines of code changed in 1 file:

  • AWTC: awtc_next_neighbours.hxx (+1 -1)
westram 2013-02-09 13:52 Rev.: 9521


- updated depends for [9520]

2 lines of code changed in 1 file:

  • AWTC: Makefile (+2)
westram 2013-02-09 12:16 Rev.: 9516


- reintegrated branch 'cxx11'

2 lines of code changed in 1 file:

  • AWTC: Makefile (+2)
westram 2012-11-23 18:58 Rev.: 9225


* rename unit test macros
- TEST_ASSERT.. -> TEST_EXPECT..

27 lines of code changed in 1 file:

  • AWTC: AWTC_next_neighbours.cxx (+27 -27)
westram 2012-09-27 14:02 Rev.: 8962


* added auto-update-code for normal ptserver
* inserted '...' behind 'GUUUGAUCAAGUCGAGCGGU' in ptserver-test-source-DB
- probe has exactly two occurrances in the middle of the sequence data
- updated test-results for changed data
* ran TEST_SLOW_find_unmatched_probes to check for further index-errors
- no additional errors caused
- i.e. index-errors seem to occur only on 3'-end

3 lines of code changed in 1 file:

  • AWTC: AWTC_next_neighbours.cxx (+3 -3)
westram 2012-05-22 18:11 Rev.: 8744


* AISC clients
- client-handles for server-side objects are distinguishable types now (esp. can no longer be confounded w/o compiler messages)
- main server object has to be passed to aisc_close

36 lines of code changed in 2 files:

  • AWTC: AWTC_next_neighbours.cxx (+35 -22), awtc_next_neighbours.hxx (+1 -4)
westram 2012-04-25 09:10 Rev.: 8661


- scaling awar (next neighbour search) was defined at wrong place (EDIT4/Aligner/MoreSettings crashed)

1 lines of code changed in 1 file:

  • AWTC: AWTC_next_neighbours.cxx (+1)
westram 2012-04-19 12:54 Rev.: 8614


merge from e4fix [8168] [8169] [8170] [8171] [8178] [8180] [8181] [8182] [8183] [8184] [8185] [8187] [8188] [8189]

* merge similar concepts !UpdateRange and !TargetRange into !PosRange
- moved to CORE
- added !ExplicitRange
- added PosRange::contains()
- able to intersect
- use in
* !AlignParams
* readCompactedSequence()
* !UnalignedBases + !UnalignedBasesList -> !LooseBases
* to handle selection (aka "block") in edit4
* for update interval (draw functions)
* build_probe_match_string
* added !AliChange
- holds sequence before and after alignment
* DRYed code of calc_intervall_displayed_in_rectangle vs calc_update_intervall
* cache sequence length in ED4_orf_terminal
* added test for !UnalignedBasesList (documenting wrong behavior)
* renamed all *.stamp to stamp.*

22 lines of code changed in 3 files:

  • AWTC: AWTC_next_neighbours.cxx (+13 -59), Makefile (+1), awtc_next_neighbours.hxx (+8 -48)
westram 2012-04-11 13:19 Rev.: 8574


* [8567] failed on WCs where shared libs were up-to-date, but not yet present in $ARBHOME/lib
- link libs directly in $ARBHOME/lib
* no longer create 'SHARED.a' in shared-library-dirs
* unit tests caused build of 'SHARED.so' (instead of 'libSHARED.so'). Every library existed twice.
- changed test-target-names for shared libaries (e.g. ARBDB/ARBDB.test -> ARBDB/libARBDB.test)
- added failing stopper targets to main-Makefile and shared-lib-Makefiles
* changed all dependencies to shared libs
* fixed dependency scripts to perform correct translations from lib/libUNIT.so <-> UNIT/UNIT.(dummy|a). omg :/
* updated predefined RESTRICT_LIB entries in UNIT_TESTER/Makefile.setup.template
- check whether RESTRICT_LIB uses obsolete test-names (e.g. ARBDB instead of libARBDB) and fail if.

1 lines of code changed in 1 file:

  • AWTC: needs_libs (+1 -1)

(200 more)

Generated by StatSVN 0.7.0