ARB
AWTC_next_neighbours.cxx
Go to the documentation of this file.
1 // ================================================================ //
2 // //
3 // File : AWTC_next_neighbours.cxx //
4 // Purpose : //
5 // //
6 // Institute of Microbiology (Technical University Munich) //
7 // http://www.arb-home.de/ //
8 // //
9 // ================================================================ //
10 
11 #include "awtc_next_neighbours.hxx"
12 
13 #include <servercntrl.h>
14 #include <PT_com.h>
15 #include <client.h>
16 #include <aw_window.hxx>
17 #include <aw_root.hxx>
18 #include <aw_awar.hxx>
19 #include <arbdbt.h>
20 #include <arb_strbuf.h>
21 
22 #include <climits>
23 
24 struct PT_FF_comImpl {
26  T_PT_MAIN com;
27  T_PT_LOCS locs;
28 
30  link(NULp)
31  {
32  ff_assert(!com.exists());
33  ff_assert(!locs.exists());
34  }
35 };
36 
37 // -------------------
38 // FamilyList
39 
41  next(NULp),
42  name(NULp),
43  matches(0),
44  rel_matches(0.0)
45 {}
46 
48  free(name);
49  delete next;
50 }
51 
53  ff_assert(!next); // only insert unlinked instances!
54 
55  if (!other) {
56  return this;
57  }
58 
59  if (matches >= other->matches) {
60  next = other;
61  return this;
62  }
63 
64  // insert into other
65  FamilyList *rest = other->next;
66  other->next = rest ? insertSortedBy_matches(rest) : this;
67 
68  return other;
69 }
70 
72  ff_assert(!next); // only insert unlinked instances!
73 
74  if (rel_matches >= other->rel_matches) {
75  next = other;
76  return this;
77  }
78 
79  // insert into other
80  FamilyList *rest = other->next;
81  other->next = rest ? insertSortedBy_rel_matches(rest) : this;
82 
83  return other;
84 
85 }
86 
87 // ---------------------
88 // FamilyFinder
89 
90 FamilyFinder::FamilyFinder(bool rel_matches_, RelativeScoreScaling scaling_) :
91  rel_matches(rel_matches_),
92  scaling(scaling_),
93  family_list(NULp),
94  hits_truncated(false),
95  real_hits(-1),
96  range(-1, -1)
97 {}
98 
101 }
102 
104  delete family_list;
105  family_list = NULp;
106 }
107 
108 // ------------------------
109 // PT_FamilyFinder
110 
111 PT_FamilyFinder::PT_FamilyFinder(GBDATA *gb_main_, int server_id_, int oligo_len_, int mismatches_, bool fast_flag_, bool rel_matches_, RelativeScoreScaling scaling_)
112  : FamilyFinder(rel_matches_, scaling_),
113  gb_main(gb_main_),
114  server_id(server_id_),
115  oligo_len(oligo_len_),
116  mismatches(mismatches_),
117  fast_flag(fast_flag_)
118 {
119  // 'mismatches' = the number of allowed mismatches
120  // 'fast_flag' = 0 -> do complete search, 1 -> search only oligos starting with 'A'
121  // 'rel_matches' = 0 -> score is number of oligo-hits, 1 -> score is relative to longer sequence (target or source) * 10
122 
123  ci = new PT_FF_comImpl;
124 }
125 
128  close();
129  delete ci;
130 }
131 
132 GB_ERROR PT_FamilyFinder::init_communication() {
133  const char *user = "PT_FamilyFinder";
134 
135  ff_assert(!ci->locs.exists());
136 
137  // connect PT server
138  if (aisc_create(ci->link, PT_MAIN, ci->com,
139  MAIN_LOCS, PT_LOCS, ci->locs,
140  LOCS_USER, user,
141  NULp)) {
142  return GB_export_error("Cannot initialize communication");
143  }
144  return NULp;
145 }
146 
147 
148 GB_ERROR PT_FamilyFinder::open(const char *servername) {
149  ff_assert(!ci->com.exists() && !ci->link);
150 
152  if (error) {
153  error = GBS_global_string("Cannot contact PT server [Reason: %s]", error);
154  }
155  else {
156  const char *socketid = GBS_read_arb_tcp(servername);
157  if (!socketid) error = GB_await_error();
158  else {
159  ci->link = aisc_open(socketid, ci->com, AISC_MAGIC_NUMBER, &error);
160  if (!error) {
161  if (!ci->link) error = "Cannot contact PT server [1]";
162  else if (init_communication()) error = "Cannot contact PT server [2]";
163  }
164  }
165  }
166 
167  ff_assert(error || (ci->com.exists() && ci->link));
168 
169  return error;
170 }
171 
172 void PT_FamilyFinder::close() {
173  if (ci->link) aisc_close(ci->link, ci->com);
174  ci->link = NULp;
175  ff_assert(!ci->com.exists());
176  ci->locs.clear();
177 }
178 
179 GB_ERROR PT_FamilyFinder::retrieve_family(const char *sequence, FF_complement compl_mode, int max_results, double min_score) {
181 
182  char *compressed_sequence = GB_command_interpreter(sequence, "|keep(acgtunACGTUN)", gb_main);
183  GB_ERROR error = NULp;
184 
185  if (!compressed_sequence) error = GB_await_error();
186  else if (!compressed_sequence[0]) error = "No data in sequence(-region)";
187  else {
188  bytestring bs;
189  bs.data = compressed_sequence;
190  bs.size = strlen(bs.data)+1;
191 
192  /* Start find_family() at the PT_SERVER
193  *
194  * Here we have to make a loop, until the match count of the
195  * first member is big enough
196  */
197 
199 
200  // create and init family finder object
201  T_PT_FAMILYFINDER ffinder;
202  if (aisc_create(ci->link, PT_LOCS, ci->locs,
203  LOCS_FFINDER, PT_FAMILYFINDER, ffinder,
204  FAMILYFINDER_PROBE_LEN, long(oligo_len), // oligo length (12 hardcoded till July 2008)
205  FAMILYFINDER_MISMATCH_NUMBER, long(mismatches), // number of mismatches (0 hardcoded till July 2008)
206  FAMILYFINDER_FIND_TYPE, long(fast_flag), // 0: complete search, 1: quick search (only search oligos starting with 'A')
207  FAMILYFINDER_SORT_TYPE, long(uses_rel_matches()), // 0: matches, 1: relative matches (0 hardcoded till July 2008)
208  FAMILYFINDER_REL_SCORING, long(get_scaling()), // scaling of relative scores
209  FAMILYFINDER_SORT_MAX, long(max_results), // speed up family sorting (only sort retrieved results)
210  FAMILYFINDER_MIN_SCORE, double(min_score), // limit hits by score
211  FAMILYFINDER_COMPLEMENT, long(compl_mode), // any combination of: 1 = forward, 2 = reverse, 4 = reverse-complement, 8 = complement (1 hardcoded in PT-Server till July 2008)
212  FAMILYFINDER_RANGE_STARTPOS, long(range.start()),
213  FAMILYFINDER_RANGE_ENDPOS, long(range.is_limited() ? range.end() : -1),
214  FAMILYFINDER_FIND_FAMILY, &bs, // RPC (has to be last parameter!)
215  NULp))
216  {
217  error = "Communication error with PT server ('retrieve_family')";
218  }
219  else {
220  char *ff_error = NULp;
221 
222  // Read family list
223  T_PT_FAMILYLIST f_list;
224  aisc_get(ci->link, PT_FAMILYFINDER, ffinder,
225  FAMILYFINDER_FAMILY_LIST, f_list.as_result_param(),
226  FAMILYFINDER_FAMILY_LIST_SIZE, &real_hits,
227  FAMILYFINDER_ERROR, &ff_error,
228  NULp);
229 
230  if (ff_error[0]) {
231  error = GBS_global_string("PTSERVER: %s", ff_error);
232  }
233  else {
234  hits_truncated = false;
235  if (max_results<1) max_results = INT_MAX;
236 
237  FamilyList *tail = NULp;
238  while (f_list.exists()) {
239  if (max_results == 0) {
240  hits_truncated = true;
241  break;
242  }
243  max_results--;
244 
245  FamilyList *fl = new FamilyList;
246 
247  (tail ? tail->next : family_list) = fl;
248  tail = fl;
249  fl->next = NULp;
250 
251  aisc_get(ci->link, PT_FAMILYLIST, f_list,
252  FAMILYLIST_NAME, &fl->name,
253  FAMILYLIST_MATCHES, &fl->matches,
254  FAMILYLIST_REL_MATCHES, &fl->rel_matches,
255  FAMILYLIST_NEXT, f_list.as_result_param(),
256  NULp);
257  }
258  }
259  free(ff_error);
260  }
261 
262  free(compressed_sequence);
263  }
264  return error;
265 }
266 
267 GB_ERROR PT_FamilyFinder::searchFamily(const char *sequence, FF_complement compl_mode, int max_results, double min_score) {
268  // searches the PT-server for species related to 'sequence'.
269  //
270  // relation-score is calculated by fragmenting the sequence into oligos of length 'oligo_len' and
271  // then summarizing the number of hits.
272  //
273  // 'max_results' limits the length of the generated result list (low scores deleted first)
274  // if < 1 -> don't limit
275  //
276  // 'min_score' limits the results by score (use 0 for unlimited results)
277  //
278  // When using restrict_2_region(), only pass the corresponding part via 'sequence' (not the full alignment)
279 
280  GB_ERROR error = range.is_empty() ? "Specified range is empty" : NULp;
281  if (!error) {
282  error = open(GBS_ptserver_tag(server_id));
283  if (!error) error = retrieve_family(sequence, compl_mode, max_results, min_score);
284  close();
285  }
286  return error;
287 }
288 
290  GBS_strstruct *out = GBS_stropen(1000);
291  for (FamilyList *fl = family_list; fl; fl = fl->next) {
292  GBS_strnprintf(out, 100, "%s/%li/%3.5f,", fl->name, fl->matches, fl->rel_matches*100);
293  }
294  GBS_str_cut_tail(out, 1);
296 }
297 
298 static void adjustOligolenAndMismatches(AW_root *aw_root, bool oligolen_changed) {
299  AW_awar *awar_oligolen = aw_root->awar(AWAR_NN_OLIGO_LEN);
300  AW_awar *awar_mismatches = aw_root->awar(AWAR_NN_MISMATCHES);
301 
302  int oligolen = awar_oligolen->read_int();
303  int mismatches = awar_mismatches->read_int();
304 
305  if (oligolen<=mismatches) { // =unwanted state
306  if (oligolen_changed) {
307  awar_mismatches->write_int(oligolen-1);
308  }
309  else {
310  awar_oligolen->write_int(mismatches+1);
311  }
312  }
313 }
314 
316  static bool created = false;
317  if (!created) {
318  aw_root->awar_int(AWAR_NN_OLIGO_LEN, 12)->set_minmax(1, 200)->add_callback(makeRootCallback(adjustOligolenAndMismatches, true))->add_callback(awar_changed_cb);
319  aw_root->awar_int(AWAR_NN_MISMATCHES, 0)->set_minmax(0, 50)->add_callback(makeRootCallback(adjustOligolenAndMismatches, false))->add_callback(awar_changed_cb);
320  aw_root->awar_int(AWAR_NN_FAST_MODE, 0)->add_callback(awar_changed_cb);
321  aw_root->awar_int(AWAR_NN_REL_MATCHES, 1)->add_callback(awar_changed_cb);
322  aw_root->awar_int(AWAR_NN_REL_SCALING, RSS_BOTH_MIN)->add_callback(awar_changed_cb);
323 
324  created = true;
325  }
326 }
327 
329  // used in several figs:
330  // - ad_spec_nn.fig
331  // - ad_spec_nnm.fig
332  // - faligner/family_settings.fig
333 
334  aws->at("oligo_len");
336 
337  aws->at("mismatches");
339 
340  aws->at("mode");
342  aws->insert_default_option("Complete", "", 0);
343  aws->insert_option("Quick", "", 1);
344  aws->update_option_menu();
345 
346  aws->at("score");
348  aws->insert_option("absolute", "", 0);
349  aws->insert_default_option("relative", "", 1);
350  aws->update_option_menu();
351 
352  aws->at("scaling");
354  aws->insert_option ("to source POC", "", RSS_SOURCE);
355  aws->insert_option ("to target POC", "", RSS_TARGET);
356  aws->insert_default_option("to maximum POC", "", RSS_BOTH_MAX);
357  aws->insert_option ("to minimum POC", "", RSS_BOTH_MIN);
358  aws->update_option_menu();
359 }
360 
361 // --------------------------------------------------------------------------------
362 
363 #ifdef UNIT_TESTS
364 
365 #include <test_unit.h>
366 
367 class ff_tester {
368  GBDATA *gb_main;
369 public:
370  bool relativeMatches;
371  bool fastMode;
372  bool partial;
373  bool shortOligo;
374  double min_score;
375 
376  RelativeScoreScaling scaling;
377 
378  ff_tester(GBDATA *gb_main_)
379  : gb_main(gb_main_),
380  relativeMatches(false),
381  fastMode(false),
382  partial(false),
383  shortOligo(false),
384  min_score(0.0),
385  scaling(RSS_BOTH_MAX)
386  {}
387 
388  const char *get_result(GB_ERROR& error) {
389  int oligoLen = shortOligo ? (partial ? 3 : 6) : (partial ? 10 : 18);
390  PT_FamilyFinder ff(gb_main, TEST_SERVER_ID, oligoLen, 1, fastMode, relativeMatches, scaling);
391 
392  const char *sequence;
393  if (partial) {
394  ff.restrict_2_region(PosRange(39, 91)); // alignment range of bases 30-69 of sequence of 'LgtLytic'
395  sequence = "UCUAGCUUGCUAGACGGGUGGCGAG" "GGUAACCGUAGGGGA"; // bases 30-54 of sequence of 'LgtLytic' + 15 bases from 'DcdNodos' (outside region)
396  }
397  else {
398  // sequence of 'LgtLytic' in TEST_pt.arb:
399  sequence = "AGAGUUUGAUCAAGUCGAACGGCAGCACAGUCUAGCUUGCUAGACGGGUGGCGAGUGGCGAACGGACUUGGGGAAACUCAAGCUAAUACCGCAUAAUCAUGACUGGGGUGAAGUCGUAACAAGGUAGCCGUAGGGGAACCUGCGGCUGGAUCACCUCCUN";
400  }
401 
402  error = ff.searchFamily(sequence, FF_FORWARD, 4, min_score);
403  return ff.results2string();
404  }
405 };
406 
407 
408 #define TEST_RELATIVES_COMMON(tester,expctd) \
409  GB_ERROR error; \
410  const char *result = tester.get_result(error); \
411  const char *expected = expctd; \
412  TEST_EXPECT_NO_ERROR(error); \
413 
414 #define TEST_EXPECT_RELATIVES(tester,expctd) do { \
415  TEST_RELATIVES_COMMON(tester,expctd); \
416  TEST_EXPECT_EQUAL(result, expected); \
417  } while(0)
418 
419 #define TEST_EXPECT_REL__BROK(tester,expctd) do { \
420  TEST_RELATIVES_COMMON(tester,expctd); \
421  TEST_EXPECT_EQUAL__BROKEN(result, expected); \
422  } while(0)
423 
424 void TEST_SLOW_PT_FamilyFinder() {
425  GB_shell shell;
426  TEST_SETUP_GLOBAL_ENVIRONMENT("ptserver");
427 
428  GBDATA *gb_main = GB_open("no.arb", "c");
429 
430  // check some error cases
431  {
432  PT_FamilyFinder ffe(gb_main, TEST_SERVER_ID, 0, 1, 0, 0, RSS_BOTH_MAX);
433  TEST_EXPECT_CONTAINS(ffe.searchFamily("whatever", FF_FORWARD, 4, 0.0), "minimum oligo length is 1");
434  }
435 
436  ff_tester test(gb_main);
437 
438  ff_tester ______RESET = test; TEST_EXPECT_RELATIVES(test, "LgtLytic/142/97.93103,HllHalod/62/43.05556,AclPleur/59/38.06452,PtVVVulg/51/34.00000");
439  test.partial = true; TEST_EXPECT_RELATIVES(test, "LgtLytic/18/11.76471,VblVulni/5/3.24675,VbhChole/4/2.59740,DcdNodos/4/2.59740");
440  test.shortOligo = true; TEST_EXPECT_RELATIVES(test, "PtVVVulg/38/23.03030,AclPleur/38/22.35294,VbhChole/38/23.60248,VblVulni/38/23.60248");
441  test.relativeMatches = true; TEST_EXPECT_RELATIVES(test, "DsssDesu/38/38.77551,CltBotul/38/34.23423,PsAAAA00/38/32.75862,Bl0LLL00/38/25.67568");
442  test.min_score = 32.6; TEST_EXPECT_RELATIVES(test, "DsssDesu/38/38.77551,CltBotul/38/34.23423,PsAAAA00/38/32.75862");
443  test = ______RESET;
444  test.shortOligo = true; TEST_EXPECT_RELATIVES(test, "LgtLytic/154/98.08917,VbhChole/133/84.17722,VblVulni/133/84.17722,HllHalod/133/85.25641");
445  test.relativeMatches = true; TEST_EXPECT_RELATIVES(test, "LgtLytic/154/98.08917,HllHalod/133/85.25641,VbhChole/133/84.17722,VblVulni/133/84.17722");
446  test.fastMode = true; TEST_EXPECT_RELATIVES(test, "LgtLytic/42/26.75159,VblVulni/37/23.41772,HllHalod/36/23.07692,Stsssola/36/23.07692");
447  test.min_score = 26.7; TEST_EXPECT_RELATIVES(test, "LgtLytic/42/26.75159");
448  test.min_score = 26.8; TEST_EXPECT_RELATIVES(test, "");
449  test = ______RESET;
450  test.fastMode = true; TEST_EXPECT_RELATIVES(test, "LgtLytic/40/27.58621,HllHalod/18/12.50000,AclPleur/17/10.96774,PtVVVulg/15/10.00000");
451  test.min_score = 17.0; TEST_EXPECT_RELATIVES(test, "LgtLytic/40/27.58621,HllHalod/18/12.50000,AclPleur/17/10.96774");
452  test.min_score = 17.5; TEST_EXPECT_RELATIVES(test, "LgtLytic/40/27.58621,HllHalod/18/12.50000");
453  test = ______RESET;
454 
455  test.shortOligo = true;
456  test.relativeMatches = true;
457  test.scaling = RSS_BOTH_MAX; TEST_EXPECT_RELATIVES(test, "LgtLytic/154/98.08917,HllHalod/133/85.25641,VbhChole/133/84.17722,VblVulni/133/84.17722");
458  test.scaling = RSS_BOTH_MIN; TEST_EXPECT_RELATIVES(test, "LgtLytic/154/98.71795,DsssDesu/84/88.42105,CltBotul/95/87.96296,PsAAAA00/97/85.84071");
459  test.scaling = RSS_TARGET; TEST_EXPECT_RELATIVES(test, "LgtLytic/154/98.08917,DsssDesu/84/88.42105,CltBotul/95/87.96296,PsAAAA00/97/85.84071");
460  test.scaling = RSS_SOURCE; TEST_EXPECT_RELATIVES(test, "LgtLytic/154/98.71795,VbhChole/133/85.25641,VblVulni/133/85.25641,HllHalod/133/85.25641");
461  test.partial = true;
462  test.shortOligo = false;
463  test.scaling = RSS_BOTH_MAX; TEST_EXPECT_RELATIVES(test, "LgtLytic/18/11.76471,VblVulni/5/3.24675,VbhChole/4/2.59740,DcdNodos/4/2.59740");
464  test.scaling = RSS_BOTH_MIN; TEST_EXPECT_RELATIVES(test, "LgtLytic/18/56.25000,VblVulni/5/15.62500,VbhChole/4/12.50000,DcdNodos/4/12.50000");
465  test.scaling = RSS_TARGET; TEST_EXPECT_RELATIVES(test, "LgtLytic/18/11.76471,VblVulni/5/3.24675,VbhChole/4/2.59740,DcdNodos/4/2.59740");
466  test.scaling = RSS_SOURCE; TEST_EXPECT_RELATIVES(test, "LgtLytic/18/56.25000,VblVulni/5/15.62500,VbhChole/4/12.50000,DcdNodos/4/12.50000");
467  test = ______RESET;
468 
469  GB_close(gb_main);
470 }
471 
472 #endif // UNIT_TESTS
473 
void insert_option(AW_label choice_label, const char *mnemonic, const char *var_value, const char *name_of_color=NULp)
void AWTC_create_common_next_neighbour_fields(AW_window *aws, int scaler_length)
const char * GB_ERROR
Definition: arb_core.h:25
GBDATA * GB_open(const char *path, const char *opent)
Definition: ad_load.cxx:1363
void GBS_strnprintf(GBS_strstruct *strstr, long maxlen, const char *templat,...)
Definition: arb_strbuf.cxx:113
int aisc_close(aisc_com *link, AISC_Object &object)
Definition: client.c:249
int start() const
Definition: pos_range.h:60
void at(int x, int y)
Definition: AW_at.cxx:93
#define TEST_SETUP_GLOBAL_ENVIRONMENT(modulename)
Definition: test_unit.h:1476
static void adjustOligolenAndMismatches(AW_root *aw_root, bool oligolen_changed)
GB_ERROR arb_look_and_start_server(long magic_number, const char *arb_tcp_env)
long read_int() const
Definition: AW_awar.cxx:184
AW_awar * set_minmax(float min, float max)
Definition: AW_awar.cxx:530
const char * GBS_global_string(const char *templat,...)
Definition: arb_msg.cxx:202
FamilyFinder(bool rel_matches_, RelativeScoreScaling scaling_)
bool is_empty() const
Definition: pos_range.h:72
void update_option_menu()
GB_ERROR searchFamily(const char *sequence, FF_complement compl_mode, int max_results, double min_score) OVERRIDE __ATTR__USERESULT
#define AWAR_NN_REL_SCALING
AW_awar * add_callback(const RootCallback &cb)
Definition: AW_awar.cxx:231
#define AWAR_NN_FAST_MODE
void create_input_field_with_scaler(const char *awar_name, int textcolumns=4, int scaler_length=250, AW_ScalerType scalerType=AW_SCALER_LINEAR)
Definition: AW_button.cxx:1143
bool is_limited() const
Definition: pos_range.h:77
#define TEST_EXPECT_CONTAINS(str, part)
Definition: test_unit.h:1301
RelativeScoreScaling
GB_ERROR GB_export_error(const char *error)
Definition: arb_msg.cxx:256
GBS_strstruct * GBS_stropen(long init_size)
Definition: arb_strbuf.cxx:39
GB_ERROR GB_await_error()
Definition: arb_msg.cxx:341
const char * GBS_read_arb_tcp(const char *env)
Definition: adtcp.cxx:325
char * data
Definition: bytestring.h:16
#define false
Definition: ureadseq.h:13
static void error(const char *msg)
Definition: mkptypes.cxx:96
bool uses_rel_matches() const
#define RETURN_LOCAL_ALLOC(mallocation)
Definition: smartptr.h:310
FamilyList * insertSortedBy_rel_matches(FamilyList *other)
const char * results2string()
void GBS_str_cut_tail(GBS_strstruct *strstr, size_t byte_count)
Definition: arb_strbuf.cxx:96
FF_complement
void AWTC_create_common_next_neighbour_vars(AW_root *aw_root, const RootCallback &awar_changed_cb)
FamilyList * family_list
AW_awar * awar(const char *awar)
Definition: AW_root.cxx:554
PT_FamilyFinder(GBDATA *gb_main_, int server_id_, int oligo_len_, int mismatches_, bool fast_flag_, bool rel_matches_, RelativeScoreScaling scaling_)
FamilyList * insertSortedBy_matches(FamilyList *other)
FamilyList * next
void insert_default_option(AW_label choice_label, const char *mnemonic, const char *var_value, const char *name_of_color=NULp)
#define AISC_MAGIC_NUMBER
Definition: client_privat.h:51
static void awar_changed_cb(AW_root *, awt_mask_awar_item *item)
AW_awar * awar_int(const char *var_name, long default_value=0, AW_default default_file=AW_ROOT_DEFAULT)
Definition: AW_root.cxx:580
aisc_com * aisc_open(const char *path, AISC_Object &main_obj, long magic, GB_ERROR *error)
Definition: client.c:205
char * GBS_strclose(GBS_strstruct *strstr)
Definition: arb_strbuf.cxx:69
AW_option_menu_struct * create_option_menu(const char *awar_name)
#define NULp
Definition: cxxforward.h:114
#define ff_assert(bed)
int aisc_get(aisc_com *link, int o_type, const AISC_Object &object,...)
Definition: client.c:266
int end() const
Definition: pos_range.h:64
char * GB_command_interpreter(const char *str, const char *commands, GBDATA *gb_main)
Definition: gb_aci.cxx:453
#define AWAR_NN_MISMATCHES
GBDATA * gb_main
Definition: adname.cxx:33
const char * GBS_ptserver_tag(int id)
Definition: adtcp.cxx:312
RelativeScoreScaling get_scaling() const
GB_ERROR write_int(long aw_int)
int aisc_create(aisc_com *link, int father_type, const AISC_Object &father, int attribute, int object_type, AISC_Object &object,...)
Definition: client.c:593
void GB_close(GBDATA *gbd)
Definition: arbdb.cxx:655
#define AWAR_NN_OLIGO_LEN
#define AWAR_NN_REL_MATCHES