adGene.cxx

Go to the documentation of this file.

// =============================================================== //
//                                                                 //
//   File      : adGene.cxx                                        //
//   Purpose   : Basic gene access functions                       //
//                                                                 //
//   Coded by Ralf Westram (coder@reallysoft.de) in July 2002      //
//   Institute of Microbiology (Technical University Munich)       //
//   http://www.arb-home.de/                                       //
//                                                                 //
// =============================================================== //

#include "gb_local.h"

#include <adGene.h>
#include <arbdbt.h>
#include <arb_strbuf.h>
#include <arb_strarray.h>


bool GEN_is_genome_db(GBDATA *gb_main, int default_value) {
    // default_value ==  0 -> default to normal database
    //               ==  1 -> default to GENOM database
    //               == -1 -> assume that type is already defined (is defined for all DBs ever loaded in ARB-gui)
    GBDATA *gb_genom_db = GB_entry(gb_main, GENOM_DB_TYPE);

    if (!gb_genom_db) {         // no DB-type entry -> create one with default
        GB_ERROR error = NULp;

        assert_or_exit(default_value != -1); // first call to GEN_is_genome_db has to provide a 'default_value'

        gb_genom_db             = GB_create(gb_main, GENOM_DB_TYPE, GB_INT);
        if (!gb_genom_db) error = GB_await_error();
        else error              = GB_write_int(gb_genom_db, default_value);

        if (error) GBK_terminatef("Fatal in GEN_is_genome_db: %s", error);
    }

    return GB_read_int(gb_genom_db) != 0;
}

//  --------------
//      genes:

GBDATA* GEN_findOrCreate_gene_data(GBDATA *gb_species) {
    GBDATA *gb_gene_data = GB_search(gb_species, "gene_data", GB_CREATE_CONTAINER);
    gb_assert(gb_gene_data);
    return gb_gene_data;
}

GBDATA* GEN_find_gene_data(GBDATA *gb_species) {
    return GB_search(gb_species, "gene_data", GB_FIND);
}

GBDATA* GEN_expect_gene_data(GBDATA *gb_species) {
    GBDATA *gb_gene_data = GB_search(gb_species, "gene_data", GB_FIND);
    gb_assert(gb_gene_data);
    return gb_gene_data;
}

GBDATA* GEN_find_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) {
    return GBT_find_item_rel_item_data(gb_gene_data, "name", name);
}

GBDATA* GEN_find_gene(GBDATA *gb_species, const char *name) {
    // Search for a gene.
    // Return found gene or NULp (in this case an error MAY be exported).
    //
    // Note: If you expect the gene to exists, use GEN_expect_gene!
    GBDATA *gb_gene_data = GEN_find_gene_data(gb_species);
    return gb_gene_data ? GEN_find_gene_rel_gene_data(gb_gene_data, name) : NULp;
}
GBDATA* GEN_expect_gene(GBDATA *gb_species, const char *name) {
    // Returns an existing gene or
    // NULp (in that case an error is exported)
    return GBT_expect_item_rel_item_data(GEN_expect_gene_data(gb_species), "name", name);
}

static GBDATA* GEN_create_nonexisting_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) {
    GB_ERROR  error   = GB_push_transaction(gb_gene_data);
    GBDATA   *gb_gene = NULp;

    gb_assert(!GEN_find_gene_rel_gene_data(gb_gene_data, name)); // don't call this function if you are not sure that the gene does not exists!

    if (!error) {
        gb_gene = GB_create_container(gb_gene_data, "gene");
        error   = gb_gene ? GBT_write_string(gb_gene, "name", name) : GB_await_error();
    }

    gb_assert(gb_gene || error);
    error = GB_end_transaction(gb_gene_data, error);
    if (error) GB_export_error(error);

    return gb_gene;
}

GBDATA* GEN_create_nonexisting_gene(GBDATA *gb_species, const char *name) { // needed by ../PERL_SCRIPTS/GENOME/GI.pm@create_nonexisting_gene
    return GEN_create_nonexisting_gene_rel_gene_data(GEN_findOrCreate_gene_data(gb_species), name); 
} 

GBDATA* GEN_find_or_create_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) {
    GBDATA *gb_gene = NULp;

    // Search for a gene, when gene does not exist create it
    if (!name || !name[0]) {
        GB_export_error("Missing gene name");
    }
    else {
        GBDATA *gb_name = GB_find_string(gb_gene_data, "name", name, GB_IGNORE_CASE, SEARCH_GRANDCHILD);

        if (gb_name) {
            gb_gene = GB_get_father(gb_name); // found existing gene
        }
        else {
            GB_ERROR error = GB_push_transaction(gb_gene_data);

            if (!error) {
                gb_gene = GB_create_container(gb_gene_data, "gene");
                error   = GBT_write_string(gb_gene, "name", name);
            }
            error = GB_end_transaction(gb_gene_data, error);
            if (error) {
                gb_gene = NULp;
                GB_export_error(error);
            }
        }
    }
    return gb_gene;
}

GBDATA* GEN_first_gene(GBDATA *gb_species) {
    return GB_entry(GEN_expect_gene_data(gb_species), "gene");
}

GBDATA* GEN_first_gene_rel_gene_data(GBDATA *gb_gene_data) {
    return GB_entry(gb_gene_data, "gene");
}

GBDATA* GEN_next_gene(GBDATA *gb_gene) {
    gb_assert(GB_has_key(gb_gene, "gene"));
    return GB_nextEntry(gb_gene);
}

GBDATA *GEN_first_marked_gene(GBDATA *gb_species) {
    return GB_first_marked(GEN_expect_gene_data(gb_species), "gene");
}
GBDATA *GEN_next_marked_gene(GBDATA *gb_gene) {
    return GB_next_marked(gb_gene, "gene");
}

// ----------------------
//      gene position

static GEN_position *lastFreedPosition = NULp;

GEN_position *GEN_new_position(int parts, bool joinable) {
    GEN_position *pos;

    size_t pos_size  = parts*sizeof(pos->start_pos[0]);
    size_t comp_size = parts*sizeof(pos->complement[0]);
    size_t data_size = 2*pos_size+3*comp_size;

    gb_assert(parts>0);

    if (lastFreedPosition && lastFreedPosition->parts == parts) {
        pos               = lastFreedPosition;
        lastFreedPosition = NULp;
        memset(pos->start_pos, 0, data_size);
    }
    else {
        ARB_calloc(pos, 1);
        pos->parts      = parts;
        pos->start_pos  = (size_t*)ARB_calloc<char>(data_size);
        pos->stop_pos   = pos->start_pos+parts;
        pos->complement = (unsigned char*)(pos->stop_pos+parts);
    }

    pos->joinable        = joinable;
    pos->start_uncertain = NULp;
    pos->stop_uncertain  = NULp;

    return pos;
}

void GEN_use_uncertainties(GEN_position *pos) {
    if (!pos->start_uncertain) {
        // space was already allocated in GEN_new_position
        pos->start_uncertain = pos->complement+pos->parts;
        pos->stop_uncertain  = pos->start_uncertain+pos->parts;

        size_t comp_size = pos->parts*sizeof(pos->complement[0]);
        memset(pos->start_uncertain, '=', 2*comp_size);
    }
}

void GEN_free_position(GEN_position *pos) {
    if (pos) {
        if (lastFreedPosition) {
            free(lastFreedPosition->start_pos); // rest is allocated together with start_pos
            free(lastFreedPosition);
        }

        lastFreedPosition = pos;
    }
}

static struct GEN_position_mem_handler {
    ~GEN_position_mem_handler() { GEN_free_position(NULp); }
} GEN_position_dealloc;


static GB_ERROR parseCSV(GBDATA *gb_gene, const char *field_name, size_t parts_expected, ConstStrArray& parseTable) {
    // reads a field and splits the content at ','
    // results are stored in parseTable

    GB_ERROR  error      = NULp;
    GBDATA   *gb_field   = GB_entry(gb_gene, field_name);
    if (!gb_field) error = GBS_global_string("Expected entry '%s' missing", field_name);
    else {
        char *content       = GB_read_string(gb_field);
        if (!content) error = GB_await_error();
        else {
            parseTable.erase();
            GBT_splitNdestroy_string(parseTable, content, ',');
            if (parseTable.size() != parts_expected) {
                error = GBS_global_string("Expected %zu CSV, found %zu", parts_expected, parseTable.size());
            }
        }
    }
    return error;
}

static GB_ERROR parsePositions(GBDATA *gb_gene, const char *field_name, int parts_expected, size_t *results, ConstStrArray& parseTable) {
    GB_ERROR error = parseCSV(gb_gene, field_name, parts_expected, parseTable);
    if (!error) {
        int p;
        for (p = 0; p<parts_expected && !error; p++) {
            char *end;
            results[p] = strtol(parseTable[p], &end, 10);
            if (end == parseTable[p]) { // error
                error = GBS_global_string("can't convert '%s' to number", parseTable[p]);
            }
        }
    }
    if (error) {
        error = GBS_global_string("While parsing field '%s': %s", field_name, error);
    }
    return error;
}

GEN_position *GEN_read_position(GBDATA *gb_gene) {
    int           parts         = 1;
    bool          joinable      = false;
    GBDATA       *gb_pos_joined = GB_entry(gb_gene, "pos_joined");
    GEN_position *pos           = NULp;
    GB_ERROR      error         = NULp;

    if (gb_pos_joined) {
        parts = GB_read_int(gb_pos_joined);
        if (parts != 1) { // split
            if (parts>1) joinable = true;
            else if (parts<-1) parts = -parts; // neg value means "not joinable" (comes from feature location 'order(...)')
            else error = GBS_global_string("Illegal value %i in 'pos_joined'", parts);
        }
    }

    if (!error) {
        pos = GEN_new_position(parts, joinable);

        ConstStrArray parseTable;
        parseTable.reserve(parts);

        error =             parsePositions(gb_gene, "pos_start", parts, pos->start_pos, parseTable);
        if (!error) error = parsePositions(gb_gene, "pos_stop",  parts, pos->stop_pos,  parseTable);

        int p;
        if (!error) {
            error = parseCSV(gb_gene, "pos_complement",  parts, parseTable);
            for (p = 0; p<parts && !error; p++) {
                const char *val = parseTable[p];
                if ((val[0] != '0' && val[0] != '1') || val[1] != 0) {
                    error = GBS_global_string("Invalid content '%s' in 'pos_complement' (expected: \"01\")", val);
                }
                else {
                    pos->complement[p] = (unsigned char)atoi(val);
                }
            }
        }

        if (!error) {
            GBDATA *gb_pos_certain = GB_entry(gb_gene, "pos_certain");

            if (gb_pos_certain) {
                error = parseCSV(gb_gene, "pos_certain",  parts, parseTable);
                GEN_use_uncertainties(pos);
                for (p = 0; p<parts && !error; p++) {
                    const unsigned char *val = (unsigned char *)(parseTable[p]);
                    int                  vp;

                    for (vp = 0; vp<2; vp++) {
                        unsigned char c = val[vp];
                        if (c != '<' && c != '=' && c != '>' && (c != "+-"[vp])) {
                            error = GBS_global_string("Invalid content '%s' in 'pos_certain' (expected 2 from \"<=>\")", val);
                        }
                    }
                    if (!error) {
                        pos->start_uncertain[p] = val[0];
                        pos->stop_uncertain[p]  = val[1];
                    }
                }
            }
        }
    }

    gb_assert(error || pos);
    if (error) {
        GB_export_error(error);
        if (pos) {
            GEN_free_position(pos);
            pos = NULp;
        }
    }
    return pos;
}

GB_ERROR GEN_write_position(GBDATA *gb_gene, const GEN_position *pos, long seqLength) {
    // if 'seqLength' is != 0, it is used to check the correctness of 'pos'
    // (otherwise this function reads the genome-sequence to detect its length)

    GB_ERROR  error          = NULp;
    GBDATA   *gb_pos_joined  = GB_entry(gb_gene, "pos_joined");
    GBDATA   *gb_pos_certain = GB_entry(gb_gene, "pos_certain");
    GBDATA   *gb_pos_start;
    GBDATA   *gb_pos_stop;
    GBDATA   *gb_pos_complement;
    int       p;

    gb_assert(pos);

    gb_pos_start             = GB_search(gb_gene, "pos_start", GB_STRING);
    if (!gb_pos_start) error = GB_await_error();

    if (!error) {
        gb_pos_stop             = GB_search(gb_gene, "pos_stop", GB_STRING);
        if (!gb_pos_stop) error = GB_await_error();
    }
    if (!error) {
        gb_pos_complement             = GB_search(gb_gene, "pos_complement", GB_STRING);
        if (!gb_pos_complement) error = GB_await_error();
    }

    if (!error) {
        if (pos->start_uncertain) {
            if (!gb_pos_certain) {
                gb_pos_certain             = GB_search(gb_gene, "pos_certain", GB_STRING);
                if (!gb_pos_certain) error = GB_await_error();
            }
        }
        else {
            if (gb_pos_certain) {
                error          = GB_delete(gb_pos_certain);
                gb_pos_certain = NULp;
            }
        }
    }

    // test data
    if (!error) {
        size_t length;

        if (seqLength) {
            length = seqLength;
        }
        else { // unknown -> autodetect
            GBDATA *gb_organism = GB_get_grandfather(gb_gene);
            GBDATA *gb_genome   = GBT_find_sequence(gb_organism, GENOM_ALIGNMENT);

            length = GB_read_count(gb_genome);
        }

        for (p = 0; p<pos->parts && !error; ++p) {
            char c;

            c = pos->complement[p]; gb_assert(c == 0 || c == 1);
            if (c<0 || c>1) {
                error = GBS_global_string("Illegal value %i in complement", int(c));
            }
            else {
                if (pos->start_pos[p]>pos->stop_pos[p]) {
                    error = GBS_global_string("Illegal positions (%zu>%zu)", pos->start_pos[p], pos->stop_pos[p]);
                }
                else if (pos->start_pos[p] == 0) {
                    error = GBS_global_string("Illegal start position %zu", pos->start_pos[p]);
                }
                else if (pos->stop_pos[p] > length) {
                    error = GBS_global_string("Illegal stop position %zu (>length(=%zu))", pos->stop_pos[p], length);
                }
                else {
                    if (pos->start_uncertain) {
                        c       = pos->start_uncertain[p];
                        char c2 = pos->stop_uncertain[p];

                        if      (!c  || !strchr("<=>+", c))  error = GBS_global_string("Invalid uncertainty '%c'", c);
                        else if (!c2 || !strchr("<=>-", c2)) error = GBS_global_string("Invalid uncertainty '%c'", c2);
                        else {
                            if (c == '+' || c2 == '-') {
                                if (c == '+' && c2 == '-') {
                                    if (pos->start_pos[p] != pos->stop_pos[p]-1) {
                                        error = GBS_global_string("Invalid positions %zu^%zu for uncertainties +-", pos->start_pos[p], pos->stop_pos[p]);
                                    }
                                }
                                else {
                                    error = "uncertainties '+' and '-' can only be used together";
                                }
                            }
                        }
                    }
                }
            }
        }
    }

    if (!error) {
        if (pos->parts == 1) {
            if (gb_pos_joined) error = GB_delete(gb_pos_joined);

            if (!error) error = GB_write_string(gb_pos_start,      GBS_global_string("%zu", pos->start_pos[0]));
            if (!error) error = GB_write_string(gb_pos_stop,       GBS_global_string("%zu", pos->stop_pos[0]));
            if (!error) error = GB_write_string(gb_pos_complement, GBS_global_string("%c", pos->complement[0]+'0'));

            if (!error && gb_pos_certain) {
                error = GB_write_string(gb_pos_certain, GBS_global_string("%c%c", pos->start_uncertain[0], pos->stop_uncertain[0]));
            }
        }
        else {
            if (!gb_pos_joined) {
                gb_pos_joined             = GB_search(gb_gene, "pos_joined", GB_INT);
                if (!gb_pos_joined) error = GB_await_error();
            }
            if (!error) error = GB_write_int(gb_pos_joined, pos->parts * (pos->joinable ? 1 : -1)); // neg. parts means not joinable

            if (!error) {
                GBS_strstruct *start      = GBS_stropen(12*pos->parts);
                GBS_strstruct *stop       = GBS_stropen(12*pos->parts);
                GBS_strstruct *complement = GBS_stropen(2*pos->parts);
                GBS_strstruct *uncertain  = GBS_stropen(3*pos->parts);

                for (p = 0; p<pos->parts; ++p) {
                    if (p>0) {
                        GBS_chrcat(start, ',');
                        GBS_chrcat(stop, ',');
                        GBS_chrcat(complement, ',');
                        GBS_chrcat(uncertain, ',');
                    }
                    GBS_strcat(start, GBS_global_string("%zu", pos->start_pos[p]));
                    GBS_strcat(stop,  GBS_global_string("%zu", pos->stop_pos[p]));
                    GBS_chrcat(complement, pos->complement[p]+'0');
                    if (gb_pos_certain) {
                        GBS_chrcat(uncertain, pos->start_uncertain[p]);
                        GBS_chrcat(uncertain, pos->stop_uncertain[p]);
                    }
                }

                char *sstart      = GBS_strclose(start);
                char *sstop       = GBS_strclose(stop);
                char *scomplement = GBS_strclose(complement);
                char *suncertain  = GBS_strclose(uncertain);

                error             = GB_write_string(gb_pos_start, sstart);
                if (!error) error = GB_write_string(gb_pos_stop, sstop);
                if (!error) error = GB_write_string(gb_pos_complement, scomplement);
                if (!error && gb_pos_certain) error = GB_write_string(gb_pos_certain, suncertain);

                free(suncertain);
                free(scomplement);
                free(sstop);
                free(sstart);
            }
        }
    }

    return error;
}

static GEN_position *location2sort = NULp;

static int cmp_location_parts(const void *v1, const void *v2) {
    int i1 = *(int*)v1;
    int i2 = *(int*)v2;

    int cmp = location2sort->start_pos[i1]-location2sort->start_pos[i2];
    if (!cmp) {
        cmp = location2sort->stop_pos[i1]-location2sort->stop_pos[i2];
    }
    return cmp;
}

void GEN_sortAndMergeLocationParts(GEN_position *location) {
    // Note: makes location partly invalid (only start_pos + stop_pos are valid afterwards)
    int  parts = location->parts;
    int *idx   = ARB_alloc<int>(parts); // idx[newpos] = oldpos
    int  i, p;

    for (p = 0; p<parts; ++p) idx[p] = p; // IRRELEVANT_LOOP

    location2sort = location;
    qsort(idx, parts, sizeof(*idx), cmp_location_parts);
    location2sort = NULp;

    for (p = 0; p<parts; ++p) {
        i = idx[p];

#define swap(a, b, type) do { type tmp = (a); (a) = (b); (b) = (tmp); } while (0)

        if (i != p) {
            swap(location->start_pos[i],  location->start_pos[p],  size_t);
            swap(location->stop_pos[i],   location->stop_pos[p],   size_t);
            swap(idx[i], idx[p], int);
        }
    }

#if defined(DEBUG) && 0
    printf("Locations sorted:\n");
    for (p = 0; p<parts; ++p) {
        printf("  [%i] %i - %i %i\n", p, location->start_pos[p], location->stop_pos[p], (int)(location->complement[p]));
    }
#endif // DEBUG

    i = 0;
    for (p = 1; p<parts; p++) {
        if ((location->stop_pos[i]+1) >= location->start_pos[p]) {
            // parts overlap or are directly consecutive

            location->stop_pos[i]  = location->stop_pos[p];
        }
        else {
            i++;
            location->start_pos[i] = location->start_pos[p];
            location->stop_pos[i]  = location->stop_pos[p];
        }
    }
    location->parts = i+1;

#if defined(DEBUG) && 0
    parts = location->parts;
    printf("Locations merged:\n");
    for (p = 0; p<parts; ++p) {
        printf("  [%i] %i - %i %i\n", p, location->start_pos[p], location->stop_pos[p], (int)(location->complement[p]));
    }
#endif // DEBUG

    free(idx);
}



//  -----------------------------------------
//      test if species is pseudo-species

const char *GEN_origin_organism(GBDATA *gb_pseudo) {
    GBDATA *gb_origin = GB_entry(gb_pseudo, "ARB_origin_species");
    return gb_origin ? GB_read_char_pntr(gb_origin) : NULp;
}
const char *GEN_origin_gene(GBDATA *gb_pseudo) {
    GBDATA *gb_origin = GB_entry(gb_pseudo, "ARB_origin_gene");
    return gb_origin ? GB_read_char_pntr(gb_origin) : NULp;
}

bool GEN_is_pseudo_gene_species(GBDATA *gb_species) {
    return GEN_origin_organism(gb_species);
}

//  ------------------------------------------------
//      find organism or gene for pseudo-species

GB_ERROR GEN_organism_not_found(GBDATA *gb_pseudo) {
    gb_assert(GEN_is_pseudo_gene_species(gb_pseudo));
    gb_assert(!GEN_find_origin_organism(gb_pseudo, NULp));

    return GB_export_errorf("The gene-species '%s' refers to an unknown organism (%s)\n"
                            "This occurs if you rename or delete the organism or change the entry\n"
                            "'ARB_origin_species' and will most likely cause serious problems.",
                            GBT_get_name_or_description(gb_pseudo),
                            GEN_origin_organism(gb_pseudo));
}

// @@@ FIXME: missing: GEN_gene_not_found (like GEN_organism_not_found)

// ------------------------------
//      search pseudo species

static const char *pseudo_species_hash_key(const char *organism_name, const char *gene_name) {
    return GBS_global_string("%s*%s", organism_name, gene_name);
}

static GBDATA *GEN_read_pseudo_species_from_hash(const GB_HASH *pseudo_hash, const char *organism_name, const char *gene_name) {
    return (GBDATA*)GBS_read_hash(pseudo_hash, pseudo_species_hash_key(organism_name, gene_name));
}

void GEN_add_pseudo_species_to_hash(GBDATA *gb_pseudo, GB_HASH *pseudo_hash) {
    const char *organism_name = GEN_origin_organism(gb_pseudo);
    const char *gene_name     = GEN_origin_gene(gb_pseudo);

    gb_assert(organism_name);
    gb_assert(gene_name);

    GBS_write_hash(pseudo_hash, pseudo_species_hash_key(organism_name, gene_name), (long)gb_pseudo);
}

GB_HASH *GEN_create_pseudo_species_hash(GBDATA *gb_main, long additionalSize) {
    GB_HASH *pseudo_hash = GBS_create_hash(GBT_get_species_count(gb_main)+additionalSize, GB_IGNORE_CASE);
    GBDATA  *gb_pseudo;

    for (gb_pseudo = GEN_first_pseudo_species(gb_main);
         gb_pseudo;
         gb_pseudo = GEN_next_pseudo_species(gb_pseudo))
    {
        GEN_add_pseudo_species_to_hash(gb_pseudo, pseudo_hash);
    }

    return pseudo_hash;
}

GBDATA *GEN_find_pseudo_species(GBDATA *gb_main, const char *organism_name, const char *gene_name, const GB_HASH *pseudo_hash) {
    // parameter pseudo_hash :
    // 0 -> use slow direct search [if you only search one]
    // otherwise it shall be a hash generated by GEN_create_pseudo_species_hash() [if you search several times]
    // Note : use GEN_add_pseudo_species_to_hash to keep hash up-to-date
    GBDATA *gb_pseudo;

    if (pseudo_hash) {
        gb_pseudo = GEN_read_pseudo_species_from_hash(pseudo_hash, organism_name, gene_name);
    }
    else {
        for (gb_pseudo = GEN_first_pseudo_species(gb_main);
             gb_pseudo;
             gb_pseudo = GEN_next_pseudo_species(gb_pseudo))
        {
            const char *origin_gene_name = GEN_origin_gene(gb_pseudo);
            if (strcmp(gene_name, origin_gene_name) == 0) {
                const char *origin_species_name = GEN_origin_organism(gb_pseudo);
                if (strcmp(organism_name, origin_species_name) == 0) {
                    break; // found pseudo species
                }
            }
        }
    }
    return gb_pseudo;
}

// -----------------------
//      search origins

GBDATA *GEN_find_origin_organism(GBDATA *gb_pseudo, const GB_HASH *organism_hash) {
    // parameter organism_hash:
    // 0 -> use slow direct search [if you only search one or two]
    // otherwise it shall be a hash generated by GBT_create_organism_hash() [if you search several times]
    // Note : use GBT_add_item_to_hash() to keep hash up-to-date

    const char *origin_species_name;
    GBDATA     *gb_organism = NULp;
    gb_assert(GEN_is_pseudo_gene_species(gb_pseudo));

    origin_species_name = GEN_origin_organism(gb_pseudo);
    if (origin_species_name) {
        if (organism_hash) {
            gb_organism = (GBDATA*)GBS_read_hash(organism_hash, origin_species_name);
        }
        else {
            gb_organism = GBT_find_species_rel_species_data(GB_get_father(gb_pseudo), origin_species_name);
        }
    }

    return gb_organism;
}

GBDATA *GEN_find_origin_gene(GBDATA *gb_pseudo, const GB_HASH *organism_hash) {
    const char *origin_gene_name;

    gb_assert(GEN_is_pseudo_gene_species(gb_pseudo));

    origin_gene_name = GEN_origin_gene(gb_pseudo);
    if (origin_gene_name) {
        GBDATA *gb_organism = GEN_find_origin_organism(gb_pseudo, organism_hash);
        gb_assert(gb_organism);

        return GEN_find_gene(gb_organism, origin_gene_name);
    }
    return NULp;
}

//  --------------------------------
//      find pseudo-species

GBDATA* GEN_first_pseudo_species(GBDATA *gb_main) {
    GBDATA *gb_species = GBT_first_species(gb_main);

    if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) return gb_species;
    return GEN_next_pseudo_species(gb_species);
}

GBDATA* GEN_next_pseudo_species(GBDATA *gb_species) {
    if (gb_species) {
        while (1) {
            gb_species = GBT_next_species(gb_species);
            if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) break;
        }
    }
    return gb_species;
}

static GBDATA* GEN_next_marked_pseudo_species(GBDATA *gb_species) {
    if (gb_species) {
        while (1) {
            gb_species = GBT_next_marked_species(gb_species);
            if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) break;
        }
    }
    return gb_species;
}

GBDATA *GEN_first_marked_pseudo_species(GBDATA *gb_main) {
    GBDATA *gb_species = GBT_first_marked_species(gb_main);

    if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) return gb_species;
    return GEN_next_marked_pseudo_species(gb_species);
}

// ------------------
//      organisms

bool GEN_is_organism(GBDATA *gb_species) {
    gb_assert(GEN_is_genome_db(GB_get_root(gb_species), -1)); // assert this is a genome db
    // otherwise it is an error to use GEN_is_organism (or its callers)!!!!

    return GB_entry(gb_species, GENOM_ALIGNMENT);
}

GBDATA *GEN_find_organism(GBDATA *gb_main, const char *name) {
    GBDATA *gb_orga = GBT_find_species(gb_main, name);
    if (gb_orga) {
        if (!GEN_is_organism(gb_orga)) {
            fprintf(stderr, "ARBDB-warning: found unspecific species named '%s', but expected an 'organism' with that name\n", name);
            gb_orga = NULp;
        }
    }
    return gb_orga;
}

GBDATA *GEN_first_organism(GBDATA *gb_main) {
    GBDATA *gb_organism = GBT_first_species(gb_main);

    if (!gb_organism || GEN_is_organism(gb_organism)) return gb_organism;
    return GEN_next_organism(gb_organism);
}
GBDATA *GEN_next_organism(GBDATA *gb_organism) {
    if (gb_organism) {
        while (1) {
            gb_organism = GBT_next_species(gb_organism);
            if (!gb_organism || GEN_is_organism(gb_organism)) break;
        }
    }
    return gb_organism;

}

long GEN_get_organism_count(GBDATA *gb_main) {
    long    count       = 0;
    GBDATA *gb_organism = GEN_first_organism(gb_main);
    while (gb_organism) {
        count++;
        gb_organism = GEN_next_organism(gb_organism);
    }
    return count;
}


GBDATA *GEN_first_marked_organism(GBDATA *gb_main) {
    GBDATA *gb_organism = GBT_first_marked_species(gb_main);

    if (!gb_organism || GEN_is_organism(gb_organism)) return gb_organism;
    return GEN_next_marked_organism(gb_organism);
}
GBDATA *GEN_next_marked_organism(GBDATA *gb_organism) {
    if (gb_organism) {
        while (1) {
            gb_organism = GBT_next_marked_species(gb_organism);
            if (!gb_organism || GEN_is_organism(gb_organism)) break;
        }
    }
    return gb_organism;
}

char *GEN_global_gene_identifier(GBDATA *gb_gene, GBDATA *gb_organism) {
    if (!gb_organism) {
        gb_organism = GB_get_grandfather(gb_gene);
        gb_assert(gb_organism);
    }

    return GBS_global_string_copy("%s/%s", GBT_get_name_or_description(gb_organism), GBT_get_name_or_description(gb_gene));
}

// --------------------------------------------------------------------------------

#ifdef UNIT_TESTS
#include <test_unit.h>
#include <arb_unit_test.h>
#include <arb_defs.h>

static struct arb_unit_test::test_alignment_data TestAlignmentData_Genome[] = {
    { 0, "spec", "AUCUCCUAAACCCAACCGUAGUUCGAAUUGAG" },
};

#define TEST_EXPECT_MEMBER_EQUAL(s1,s2,member) TEST_EXPECT_EQUAL((s1)->member, (s2)->member)

#define TEST_EXPECT_GENPOS_EQUAL(p1,p2) do {                            \
        TEST_EXPECT_MEMBER_EQUAL(p1, p2, parts);                        \
        TEST_EXPECT_MEMBER_EQUAL(p1, p2, joinable);                     \
        for (int p = 0; p<(p1)->parts; ++p) {                           \
            TEST_EXPECT_MEMBER_EQUAL(p1, p2, start_pos[p]);             \
            TEST_EXPECT_MEMBER_EQUAL(p1, p2, stop_pos[p]);              \
            TEST_EXPECT_MEMBER_EQUAL(p1, p2, complement[p]);            \
            if ((p1)->start_uncertain) {                                \
                TEST_EXPECT_MEMBER_EQUAL(p1, p2, start_uncertain[p]);   \
                TEST_EXPECT_MEMBER_EQUAL(p1, p2, stop_uncertain[p]);    \
            }                                                           \
        }                                                               \
    } while(0)

#define TEST_WRITE_READ_GEN_POSITION(pos)                               \
    do {                                                                \
        error = GEN_write_position(gb_gene, (pos), 0);                  \
        if (!error) {                                                   \
            GEN_position *rpos = GEN_read_position(gb_gene);            \
            if (!rpos) {                                                \
                error = GB_await_error();                               \
            }                                                           \
            else {                                                      \
                TEST_EXPECT_GENPOS_EQUAL((pos), rpos);                  \
                GEN_free_position(rpos);                                \
            }                                                           \
        }                                                               \
        TEST_EXPECT_NULL(error.deliver());                              \
    } while(0)

#define TEST_WRITE_GEN_POSITION_ERROR(pos,exp_error) do {               \
        error = GEN_write_position(gb_gene, &*(pos), 0);                \
        TEST_EXPECT_EQUAL(error.deliver(), exp_error);                  \
    } while(0)
    
#define TEST_GENPOS_FIELD(field,value) do {                             \
        GBDATA *gb_field = GB_entry(gb_gene, (field));                  \
        if ((value)) {                                                  \
            TEST_REJECT_NULL(gb_field);                              \
            TEST_EXPECT_EQUAL(GB_read_char_pntr(gb_field), (value));    \
        }                                                               \
        else {                                                          \
            TEST_EXPECT_NULL(gb_field);                                 \
        }                                                               \
    } while(0)

#define TEST_GENPOS_FIELDS(start,stop,complement,certain) do {          \
        TEST_GENPOS_FIELD("pos_start", start);                          \
        TEST_GENPOS_FIELD("pos_stop", stop);                            \
        TEST_GENPOS_FIELD("pos_complement", complement);                \
        TEST_GENPOS_FIELD("pos_certain", certain);                      \
    } while(0)

#define TEST_GENE_SEQ_AND_LENGTH(werr,wseq,wlen) do {                   \
        size_t len;                                                     \
        char *seq = GBT_read_gene_sequence_and_length(gb_gene, true, '-', &len); \
        TEST_EXPECT_EQUAL(GB_have_error(), werr);                       \
        if (seq) {                                                      \
            TEST_EXPECT_EQUAL(len, (size_t)(wlen));                     \
            TEST_EXPECT_EQUAL(seq, (wseq));                             \
            free(seq);                                                  \
        }                                                               \
        else {                                                          \
            GB_clear_error();                                           \
        }                                                               \
    } while(0)
    
void TEST_GEN_position() {
    // see also ../GENOM_IMPORT/Location.cxx@TEST_gene_location

    GB_shell   shell;
    ARB_ERROR  error;
    GBDATA    *gb_main = TEST_CREATE_DB(error, "ali_genom", TestAlignmentData_Genome, false);

    TEST_EXPECT_NULL(error.deliver());

    {
        GB_transaction ta(gb_main);

        GBDATA *gb_organism  = GBT_find_species(gb_main, "spec"); TEST_REJECT_NULL(gb_organism);
        GBDATA *gb_gene_data = GEN_findOrCreate_gene_data(gb_organism); TEST_REJECT_NULL(gb_gene_data);
        GBDATA *gb_gene      = GEN_create_nonexisting_gene_rel_gene_data(gb_gene_data, "gene"); TEST_REJECT_NULL(gb_gene);

        typedef SmartCustomPtr(GEN_position, GEN_free_position) GEN_position_Ptr;
        GEN_position_Ptr pos;

        pos = GEN_new_position(1, false);

        TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal start position 0");

        pos->start_pos[0]  = 5;
        pos->stop_pos[0]   = 10;
        pos->complement[0] = 1;

        GEN_use_uncertainties(&*pos);

        TEST_WRITE_READ_GEN_POSITION(&*pos);
        TEST_GENPOS_FIELDS("5", "10", "1", "==");

        TEST_GENE_SEQ_AND_LENGTH(false, "TTTAGG", 6);

        // ----------

        pos = GEN_new_position(3, false);

        TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal start position 0");

        GEN_use_uncertainties(&*pos);

        pos->start_pos[0]  = 5;   pos->start_pos[1]  = 10;  pos->start_pos[2]  = 25;
        pos->stop_pos[0]   = 15;  pos->stop_pos[1]   = 20;  pos->stop_pos[2]   = 25;
        pos->complement[0] = 0;   pos->complement[1] = 1;   pos->complement[2] = 0;

        pos->start_uncertain[0] = '<';
        pos->stop_uncertain[2] = '>';

        TEST_WRITE_READ_GEN_POSITION(&*pos);
        TEST_GENPOS_FIELDS("5,10,25", "15,20,25", "0,1,0", "<=,==,=>");

        TEST_GENE_SEQ_AND_LENGTH(false, "CCUAAACCCAA-TACGGTTGGGT-G", 25);

        pos->stop_uncertain[2] = 'x';
        TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid uncertainty 'x'"); 

        pos->stop_uncertain[2] = '+';
        TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid uncertainty '+'"); // invalid for stop
        
        pos->start_uncertain[2] = '+';
        pos->stop_uncertain[2]  = '-';
        TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid positions 25^25 for uncertainties +-");

        pos->stop_pos[2] = 26;
        TEST_WRITE_GEN_POSITION_ERROR(pos, (void*)NULp);
        
        pos->stop_pos[0] = 100;
        TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal stop position 100 (>length(=32))");
    }

    GB_close(gb_main);
}

#endif // UNIT_TESTS