[root]/UNIT_TESTER/run
consense
(0 files, 0 lines)
1
(7 files, 475 lines)
2
(5 files, 894 lines)
3
(4 files, 1543 lines)
4
(3 files, 146 lines)
5
(1 files, 21 lines)
6
(1 files, 49 lines)
7
(1 files, 49 lines)
8
(1 files, 28 lines)
diff
(4 files, 72 lines)
display
(25 files, 17249 lines)
distance
(5 files, 151 lines)
fakehome
(0 files, 0 lines)
general
(6 files, 90 lines)
help
(3 files, 926 lines)
homefake
(0 files, 0 lines)
.arb_prop
(1 files, 1 lines)
impexp
(39 files, 4469 lines)
pars
(32 files, 1182 lines)
pvp
(4 files, 63 lines)
tools
(23 files, 475 lines)
trees
(101 files, 4349 lines)
xsub
(4 files, 511 lines)

| Author | Changes | Lines of Code | Lines per Change |
|---|---|---|---|
| westram | 134 (100.0%) | 30643 (100.0%) | 228.6 |
* reintegrates 'tree' into 'trunk'
- fixes #787
- implements #668 + #845
- contains several changes related to #774
* adds:
- log:branches/revert@18784:18786
- log:branches/tree@18706:18758,18787:19813,19816:19909
- log:branches/update@19813:19814
1 lines of code changed in 1 file:
* reintegrates 'refactor' into 'trunk'
- eliminates old interface of {{{GBS_strstruct}}}
- add a few new unittests (editor-config string + some PT-SERVER-functions)
* adds: log:branches/refactor@19300:19338
3 lines of code changed in 3 files:
* reintegrates 'split' into 'trunk'
* adds: log:branches/split@19102:19166
914 lines of code changed in 1 file:
* reintegrates 'split' into 'trunk'
- implemented beta version of alignment splitter
* adds: log:branches/split@19077:19099
1795 lines of code changed in 1 file:
* reintegrates 'unittest' into 'trunk'
* adds: log:branches/unittest@18363:18425
6399 lines of code changed in 9 files:
* reintegrates 'saicalc' into 'trunk'
- implements #730
* adds: log:branches/saicalc@18141:18310
188 lines of code changed in 1 file:
* reintegrates 'fts' into 'trunk'
* adds:
- log:branches/fts@17653,17655:17717,17724:18087
- [17925/branches/gui]
3508 lines of code changed in 3 files:
* implement GB_copy_overlay
- works like GB_copy_std if destination is empty container.
- completely overwrites existing entries including protection + marks.
- added unittests (overlay onto empty container + onto filled container). both reproduce original database ("TEST_copy.arb").
- adds an assertion vs accidently overwriting temp entries (doing so currently is "undefined behavior").
2 lines of code changed in 1 file:
* fix number of tabs between key and data (ASCII DB format)
- auto-updated all databases.
3133 lines of code changed in 8 files:
* reintegrates 'clone' into 'trunk'
* adds: log:branches/clone@17813:17835
234 lines of code changed in 2 files:
* reintegrates 'mix' into 'trunk'
- improve git/svn interoperability
* adds: log:branches/mix@17637:17640
2 lines of code changed in 1 file:
* applying ACI to groupname only had an effect together with overwrite mode {{{KEEP_OLD_NAMES}}}. fixed.
4 lines of code changed in 1 file:
* reintegrates 'group' into 'trunk'
- implements #780
* adds: log:branches/group@17162:17190,17261:17341
98 lines of code changed in 6 files:
* reintegrates 'tree' into 'trunk'
- implements #735
* adds:
- log:branches/addtest@17040:17044
- log:branches/tree@16921:17109
0 lines of code changed in 1 file:
* reintegrates 'unittest' into 'trunk'
- fixed non-deterministic behavior of add-species:
* 2 sequences in test-DB were identical (changed 1 bp)
* {{{AP_tree_edge}}} cannot be used to store insert-positions (uses pair of {{{AP_tree_nlen}}} instead)
* corrected some undefined behavior (results did depend on compiler version+flags):
- general order of inserts was undefined
- order of initial-insert was undefined (used by complete tree reconstruction)
- bugs fixed:
* not all possible insert-positions were tested
* sometimes species were added at wrong positions
* if multiple species were inserted at the same position, the following optimization
- did modify topology
- now optimizes all multi-inserts globally
- at leaf-positions: includes the leaf (Note: this does not modify the original topology)
* insert order now is "longest sequence first" (was "shortest sequence first")
- fixed unwanted behavior when testing for content of generated files
* adds: log:branches/unittest@16807:16860
0 lines of code changed in 1 file:
* reintegrates 'aci' into 'trunk'
- split TEST_GB_command_interpreter (too big, esp. for sanitizer)
- fix undefined behavior in {{{GBS_regreplace}}}
- reduce test DB
* adds: log:branches/aci@16376:16382
85 lines of code changed in 1 file:
* reintegrates 'saiexport' into 'trunk'
- implements #743
* adds: log:branches/saiexport@16023:16118
1667 lines of code changed in 1 file:
* reintegrates 'fix' into 'trunk'
- adds markerline to load/save-test-DB (bitstring data)
- store encoding in cached bitstring entries (to avoid cache-hit returns wrong encoding; fixes #760)
* adds: log:branches/fix@16072:16076
18 lines of code changed in 4 files:
* reintegrates 'fix' into 'trunk'
- automatically deletes field 'group_name' at root of tree
- done while loading tree
- provides workaround for #753
* adds: log:branches/fix@15870:15875
0 lines of code changed in 1 file:
* reintegrates 'db' into 'trunk'
- fixes #742
* adds: log:branches/db@15618:15623
100 lines of code changed in 3 files:
* merge [14675:14681] from 'gde' into 'trunk'
- change DB interface function concerned with GB_FLOAT from double -> float
- introduce more stable ascii <-> float conversion
* adds: log:branches/gde@14676:14681
18 lines of code changed in 4 files:
* reintegrates 'dbsave' into 'trunk'
- implements #665
* adds: log:branches/dbsave@14521:14555
0 lines of code changed in 7 files:
* adds a "no color" entry to colorset in test DB (as generated by pre-[14094] versions)
* auto-remove such entries in rename-session
1 lines of code changed in 2 files:
* correct stored colorsets when committing rename-session (fixes #660)
* summarize failures when restoring a colorset
1 lines of code changed in 1 file:
* add a colorset to test DB
35 lines of code changed in 3 files:
* reintegrates 'ptsfix' into 'trunk'
- fixes #659
* adds:
- log:branches/ptsfix@13960:13969
16 lines of code changed in 4 files:
* reintegrates 'pars' into 'trunk'
- fixes #528, #609, #620, #631, #633, #640, #641
- implements #619, #627
* adds:
- log:branches/addtest@13123:13260,13523:13551,13570
- log:branches/check@13365:13375,13450:13457
- log:branches/check2@13458:13465
- log:branches/fix@13522:13588
- log:branches/fixres@13270:13277,13279:13293,13295:13326
- log:branches/pars@12938:13280,13282:13325,13327:13387,13389:13527,13530:13624
83 lines of code changed in 3 files:
* reintegrates 'slv' into 'trunk'
* performs #624
* adds:
- log:branches/slv@13152:13190
9 lines of code changed in 2 files:
* reintegrates 'alilink' into 'trunk'
- fixes #419, #145, #563
* adds:
- log:branches/addtest@12468:12472
- log:branches/alilink@12419:12421,12423:12429,12431:12432,12437:12601,12603:12666
- log:branches/oldrealign@12499,12501,12537,12541,12548,12595,12607,12612,12616,12620,12625,12628,12634,12641
1376 lines of code changed in 1 file:
* reintegrates 'tree' into 'trunk'
- fixing #507
* adds:
- log:branches/tree@12004:12019
0 lines of code changed in 1 file:
* reintegrates 'tree' into 'trunk'
- implements #417 (multifurcate tree)
- tree display
* adds MULTIFURC MODE
* reordered modes (synchronizes NTREE and PARSIMONY)
- branch analysis
* display number of multifurcations in 'mark long branches'
* display "in-tree-distance" and "per-species-distance"
- added function to toggle '100%' bootstraps
- document bug in GBT_remove_leafs (#452)
* adds:
- log:branches/tree@11425:11487
0 lines of code changed in 1 file:
* reintegrates 'ptsfix' into 'trunk':
* adds:
- log:branches/ptsdump@8966:9000
- log:branches/ptsfix@8965:9012,9014:9017,9019:9023,9025:9046,9048:9089,9091:9114,9116:9132,9134:9139,9141:9145,9147:9151,9153:9158,9160:9379,9381:11059
- log:branches/ptsstartup@9160:9235,9237:9278,9280:9336,9339:9361,9363:9446
- log:branches/ptsundef@9061:9358
3597 lines of code changed in 4 files:
* added unit test for rename-session
- does not use nameserver (just tests renaming of species and correction of names in trees and configs)
1400 lines of code changed in 1 file:
- added species configurations to test DB
22 lines of code changed in 2 files:
* Tree IO (patch reintegrates branch 'tree')
- added unit test (!TreeReader, export/import consistency for most export-parameters combinations)
- refactorings: moved more behavior into !TreeReader; deny access to class internals
- improved error messages/warnings
* show error-position in input data when bailing out
* warn about unused data behind tree
* trees < 2 species produce error now
- behavior
* fixed export/import of bootstrap values (expect ':' as separator; avoiding misinterpretation of group names starting with digits)
* auto-name unnamed nodes
* supports bootstrap values specified as percent (e.g. '12.5%')
* no longer interpret {{{''}}} as escape sequence for a single {{{'}}}
* no longer remove leading '_' from leaf-/groupnames (no idea why this was done)
- fixes:
* export+import of tree using double quotes often resulted in leaf-/groupnames enclosed in double-quotes (or more often failed to load completely)
* name of root-node was lost after import.
* better support for single-node subtrees, e.g. '(leafname)'. Nodes were skipped.
* deadlock occurring when tree file was truncated somewhere in the middle.
* leaks stuffed
0 lines of code changed in 1 file:
* added unit test reading corrupted tree file
- checks for proper failure
- failed till [10278]; succeeds now
72 lines of code changed in 1 file:
* added a unit test for genome file importer (currently disabled because it segfaults)
- test uses flatfile attached to #335
- expected test result has been generated with [7813] where importer still worked
953 lines of code changed in 2 files:
- added unit-test for GB_optimize
1378 lines of code changed in 2 files:
* added auto-update-code for normal ptserver
* inserted '...' behind 'GUUUGAUCAAGUCGAGCGGU' in ptserver-test-source-DB
- probe has exactly two occurrances in the middle of the sequence data
- updated test-results for changed data
* ran TEST_SLOW_find_unmatched_probes to check for further index-errors
- no additional errors caused
- i.e. index-errors seem to occur only on 3'-end
4 lines of code changed in 3 files:
* added unit-tests for sequence compression (by master-sequences)
- shows input-restrictions of g_b_put_number2
0 lines of code changed in 1 file:
(18 more)