Directory UNIT_TESTER/run/

Directory Created:
2010-02-18 09:12
Total Files:
42
Deleted Files:
3
Lines of Code:
21338

[root]/UNIT_TESTER/run
            directory in repo consense (0 files, 0 lines)
                directory in repo 1 (7 files, 475 lines)
                directory in repo 2 (5 files, 894 lines)
                directory in repo 3 (4 files, 1543 lines)
                directory in repo 4 (3 files, 146 lines)
                directory in repo 5 (1 files, 21 lines)
                directory in repo 6 (1 files, 49 lines)
                directory in repo 7 (1 files, 49 lines)
                directory in repo 8 (1 files, 28 lines)
            directory in repo diff (4 files, 72 lines)
            directory in repo display (25 files, 17249 lines)
            directory in repo distance (5 files, 151 lines)
            Folder removed from repo fakehome (0 files, 0 lines)
            directory in repo general (6 files, 90 lines)
            directory in repo help (3 files, 926 lines)
            directory in repo homefake (0 files, 0 lines)
                directory in repo .arb_prop (1 files, 1 lines)
            directory in repo impexp (39 files, 4469 lines)
            directory in repo pars (32 files, 1182 lines)
            directory in repo pvp (4 files, 63 lines)
            directory in repo tools (23 files, 475 lines)
            directory in repo trees (101 files, 4349 lines)
            directory in repo xsub (4 files, 511 lines)

Lines of Code

UNIT_TESTER/run/ Lines of Code

Developers

Author Changes Lines of Code Lines per Change
westram 134 (100.0%) 30643 (100.0%) 228.6

Most Recent Commits

westram 2026-06-26 15:01 Rev.: 19910


* reintegrates 'tree' into 'trunk'
- fixes #787
- implements #668 + #845
- contains several changes related to #774
* adds:
- log:branches/revert@18784:18786
- log:branches/tree@18706:18758,18787:19813,19816:19909
- log:branches/update@19813:19814

1 lines of code changed in 1 file:

  • UNIT_TESTER/run: group_xfer_21.log.expected (+1 -1)
westram 2022-11-13 16:47 Rev.: 19339


* reintegrates 'refactor' into 'trunk'
- eliminates old interface of {{{GBS_strstruct}}}
- add a few new unittests (editor-config string + some PT-SERVER-functions)
* adds: log:branches/refactor@19300:19338

3 lines of code changed in 3 files:

  • UNIT_TESTER/run: TEST_gpt.arb.expected (changed), TEST_gpt_src.arb (+3), TEST_trees.arb (changed)
westram 2022-07-21 14:01 Rev.: 19167


* reintegrates 'split' into 'trunk'
* adds: log:branches/split@19102:19166

914 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_split_expected.arb (+914 -47)
westram 2022-06-29 14:54 Rev.: 19100


* reintegrates 'split' into 'trunk'
- implemented beta version of alignment splitter
* adds: log:branches/split@19077:19099

1795 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_split_expected.arb (new 1795)
westram 2020-04-01 17:21 Rev.: 18426


* reintegrates 'unittest' into 'trunk'
* adds: log:branches/unittest@18363:18425

6399 lines of code changed in 9 files:

  • UNIT_TESTER/run: TEST_aci.arb (+50 -53), TEST_fields_ascii.arb (+1524 -1525), TEST_gpt_src.arb (+84 -72), TEST_nuc.arb (+542 -543), TEST_nuc_short.arb (new 767), TEST_prot.arb (+1152 -1152), TEST_prot_tiny.arb (+1152 -1152), TEST_pt_src.arb (+172 -172), TEST_realign.arb (+956 -956)
westram 2020-02-21 14:07 Rev.: 18311


* reintegrates 'saicalc' into 'trunk'
- implements #730
* adds: log:branches/saicalc@18141:18310

188 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_calcSAI_expectd.arb (new 188)
westram 2019-09-17 15:13 Rev.: 18088


* reintegrates 'fts' into 'trunk'
* adds:
- log:branches/fts@17653,17655:17717,17724:18087
- [17925/branches/gui]

3508 lines of code changed in 3 files:

  • UNIT_TESTER/run: TEST_fields_ascii.arb (new 2089), TEST_fields_cloned_expected.arb (new 848), TEST_fields_xferred_expected.arb (new 571)
westram 2019-07-12 14:08 Rev.: 17956


* implement GB_copy_overlay
- works like GB_copy_std if destination is empty container.
- completely overwrites existing entries including protection + marks.
- added unittests (overlay onto empty container + onto filled container). both reproduce original database ("TEST_copy.arb").
- adds an assertion vs accidently overwriting temp entries (doing so currently is "undefined behavior").

2 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_copy_noProtect.arb (+2 -2)
westram 2019-07-08 10:26 Rev.: 17953


* fix number of tabs between key and data (ASCII DB format)
- auto-updated all databases.

3133 lines of code changed in 8 files:

  • UNIT_TESTER/run: AB735678_expected.arb (+346 -346), TEST_arbdbserver_save_expected.arb (+78 -78), TEST_copy.arb (+79 -79), TEST_copy_noProtect.arb (+79 -79), TEST_loadsave_ascii.arb (+78 -78), TEST_opti_ascii_in.arb (+1162 -1162), TEST_opti_ascii_renamed_expected.arb (+1162 -1162), TEST_pt_cleaned_expected.arb (+149 -149)
westram 2019-04-29 14:44 Rev.: 17836


* reintegrates 'clone' into 'trunk'
* adds: log:branches/clone@17813:17835

234 lines of code changed in 2 files:

  • UNIT_TESTER/run: TEST_copy.arb (new 117), TEST_copy_noProtect.arb (new 117)
westram 2019-03-04 20:39 Rev.: 17641


* reintegrates 'mix' into 'trunk'
- improve git/svn interoperability
* adds: log:branches/mix@17637:17640

2 lines of code changed in 1 file:

  • UNIT_TESTER/run: .gitignore (new 2)
westram 2018-09-03 13:19 Rev.: 17348


* applying ACI to groupname only had an effect together with overwrite mode {{{KEEP_OLD_NAMES}}}. fixed.

4 lines of code changed in 1 file:

  • UNIT_TESTER/run: group_xfer_32_li.log.expected (+4 -4)
westram 2018-08-30 17:24 Rev.: 17342


* reintegrates 'group' into 'trunk'
- implements #780
* adds: log:branches/group@17162:17190,17261:17341

98 lines of code changed in 6 files:

  • UNIT_TESTER/run: group_xfer_11.log.expected (new 14), group_xfer_21.log.expected (new 14), group_xfer_32.log.expected (new 17), group_xfer_32_li.log.expected (new 18), group_xfer_32_rc.log.expected (new 17), group_xfer_32_rel.log.expected (new 18)
westram 2018-06-15 13:08 Rev.: 17110


* reintegrates 'tree' into 'trunk'
- implements #735
* adds:
- log:branches/addtest@17040:17044
- log:branches/tree@16921:17109

0 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_trees.arb (changed)
westram 2018-02-15 12:51 Rev.: 16861


* reintegrates 'unittest' into 'trunk'
- fixed non-deterministic behavior of add-species:
* 2 sequences in test-DB were identical (changed 1 bp)
* {{{AP_tree_edge}}} cannot be used to store insert-positions (uses pair of {{{AP_tree_nlen}}} instead)
* corrected some undefined behavior (results did depend on compiler version+flags):
- general order of inserts was undefined
- order of initial-insert was undefined (used by complete tree reconstruction)
- bugs fixed:
* not all possible insert-positions were tested
* sometimes species were added at wrong positions
* if multiple species were inserted at the same position, the following optimization
- did modify topology
- now optimizes all multi-inserts globally
- at leaf-positions: includes the leaf (Note: this does not modify the original topology)
* insert order now is "longest sequence first" (was "shortest sequence first")
- fixed unwanted behavior when testing for content of generated files
* adds: log:branches/unittest@16807:16860

0 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_trees.arb (changed)
westram 2017-09-18 19:57 Rev.: 16383


* reintegrates 'aci' into 'trunk'
- split TEST_GB_command_interpreter (too big, esp. for sanitizer)
- fix undefined behavior in {{{GBS_regreplace}}}
- reduce test DB
* adds: log:branches/aci@16376:16382

85 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_aci.arb (new 85)
westram 2017-07-10 12:29 Rev.: 16119


* reintegrates 'saiexport' into 'trunk'
- implements #743
* adds: log:branches/saiexport@16023:16118

1667 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_prot_tiny.arb (new 1667)
westram 2017-07-04 17:25 Rev.: 16077


* reintegrates 'fix' into 'trunk'
- adds markerline to load/save-test-DB (bitstring data)
- store encoding in cached bitstring entries (to avoid cache-hit returns wrong encoding; fixes #760)
* adds: log:branches/fix@16072:16076

18 lines of code changed in 4 files:

  • UNIT_TESTER/run: TEST_arbdbserver_save_expected.arb (+9), TEST_loadsave.arb (changed), TEST_loadsave_ascii.arb (+9), TEST_loadsave_quick.a00 (changed)
westram 2017-05-03 15:31 Rev.: 15876


* reintegrates 'fix' into 'trunk'
- automatically deletes field 'group_name' at root of tree
- done while loading tree
- provides workaround for #753
* adds: log:branches/fix@15870:15875

0 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_nuc_seqcompr_exp.arb (changed)
westram 2017-01-25 18:54 Rev.: 15624


* reintegrates 'db' into 'trunk'
- fixes #742
* adds: log:branches/db@15618:15623

100 lines of code changed in 3 files:

  • UNIT_TESTER/run: TEST_opti_ascii_in.arb (+50), TEST_opti_ascii_renamed_expected.arb (+50), TEST_opti_expected.arb (changed)
westram 2016-01-28 09:33 Rev.: 14682


* merge [14675:14681] from 'gde' into 'trunk'
- change DB interface function concerned with GB_FLOAT from double -> float
- introduce more stable ascii <-> float conversion
* adds: log:branches/gde@14676:14681

18 lines of code changed in 4 files:

  • UNIT_TESTER/run: TEST_arbdbserver_save_expected.arb (+9 -17), TEST_loadsave.arb (changed), TEST_loadsave_ascii.arb (+9 -1), TEST_loadsave_quick.a00 (changed)
westram 2015-11-27 20:31 Rev.: 14556


* reintegrates 'dbsave' into 'trunk'
- implements #665
* adds: log:branches/dbsave@14521:14555

0 lines of code changed in 7 files:

  • UNIT_TESTER/run: AB735678_expected.arb (-9), TEST_gpt.arb.expected (changed), TEST_loadsave.arb (changed), TEST_nuc_seqcompr_exp.arb (changed), TEST_opti_ascii_in.arb (-10), TEST_opti_ascii_renamed_expected.arb (-10), TEST_opti_expected.arb (changed)
westram 2015-07-31 11:43 Rev.: 14116


* adds a "no color" entry to colorset in test DB (as generated by pre-[14094] versions)
* auto-remove such entries in rename-session

1 lines of code changed in 2 files:

  • UNIT_TESTER/run: TEST_opti_ascii_in.arb (+1 -1), TEST_opti_expected.arb (changed)
westram 2015-07-31 11:21 Rev.: 14115


* correct stored colorsets when committing rename-session (fixes #660)
* summarize failures when restoring a colorset

1 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_opti_ascii_renamed_expected.arb (+1 -1)
westram 2015-07-31 10:22 Rev.: 14114


* add a colorset to test DB

35 lines of code changed in 3 files:

  • UNIT_TESTER/run: TEST_opti_ascii_in.arb (+18), TEST_opti_ascii_renamed_expected.arb (+17), TEST_opti_expected.arb (changed)
westram 2015-07-04 14:00 Rev.: 13970


* reintegrates 'ptsfix' into 'trunk'
- fixes #659
* adds:
- log:branches/ptsfix@13960:13969

16 lines of code changed in 4 files:

  • UNIT_TESTER/run: TEST_pt.arb.pt.expected (changed), TEST_pt_cleaned_expected.arb (+2 -2), TEST_pt_src.arb (+2 -2), index_pt.dump.expected (+12 -12)
westram 2015-03-29 12:47 Rev.: 13625


* reintegrates 'pars' into 'trunk'
- fixes #528, #609, #620, #631, #633, #640, #641
- implements #619, #627
* adds:
- log:branches/addtest@13123:13260,13523:13551,13570
- log:branches/check@13365:13375,13450:13457
- log:branches/check2@13458:13465
- log:branches/fix@13522:13588
- log:branches/fixres@13270:13277,13279:13293,13295:13326
- log:branches/pars@12938:13280,13282:13325,13327:13387,13389:13527,13530:13624

83 lines of code changed in 3 files:

  • UNIT_TESTER/run: TEST_prot.arb (+80 -42), TEST_realign.arb (+3 -3), TEST_trees.arb (changed)
westram 2014-11-17 16:42 Rev.: 13191


* reintegrates 'slv' into 'trunk'
* performs #624
* adds:
- log:branches/slv@13152:13190

9 lines of code changed in 2 files:

  • UNIT_TESTER/run: TEST_pt_cleaned_expected.arb (+4), TEST_pt_src.arb (+5 -1)
westram 2014-08-04 17:25 Rev.: 12667


* reintegrates 'alilink' into 'trunk'
- fixes #419, #145, #563
* adds:
- log:branches/addtest@12468:12472
- log:branches/alilink@12419:12421,12423:12429,12431:12432,12437:12601,12603:12666
- log:branches/oldrealign@12499,12501,12537,12541,12548,12595,12607,12612,12616,12620,12625,12628,12634,12641

1376 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_realign.arb (new 1376)
westram 2014-04-14 17:07 Rev.: 12020


* reintegrates 'tree' into 'trunk'
- fixing #507
* adds:
- log:branches/tree@12004:12019

0 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_trees.arb (changed)
westram 2014-01-20 17:08 Rev.: 11488


* reintegrates 'tree' into 'trunk'
- implements #417 (multifurcate tree)
- tree display
* adds MULTIFURC MODE
* reordered modes (synchronizes NTREE and PARSIMONY)
- branch analysis
* display number of multifurcations in 'mark long branches'
* display "in-tree-distance" and "per-species-distance"
- added function to toggle '100%' bootstraps
- document bug in GBT_remove_leafs (#452)
* adds:
- log:branches/tree@11425:11487

0 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_trees.arb (changed)
westram 2013-11-03 15:42 Rev.: 11060


* reintegrates 'ptsfix' into 'trunk':
* adds:
- log:branches/ptsdump@8966:9000
- log:branches/ptsfix@8965:9012,9014:9017,9019:9023,9025:9046,9048:9089,9091:9114,9116:9132,9134:9139,9141:9145,9147:9151,9153:9158,9160:9379,9381:11059
- log:branches/ptsstartup@9160:9235,9237:9278,9280:9336,9339:9361,9363:9446
- log:branches/ptsundef@9061:9358

3597 lines of code changed in 4 files:

  • UNIT_TESTER/run: TEST_gpt.arb.pt.expected (changed), TEST_pt.arb.pt.expected (changed), index_gpt.dump.expected (new 195), index_pt.dump.expected (new 3402)
westram 2013-09-09 13:41 Rev.: 10559


* added unit test for rename-session
- does not use nameserver (just tests renaming of species and correction of names in trees and configs)

1400 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_opti_ascii_renamed_expected.arb (new 1400)
westram 2013-09-09 13:23 Rev.: 10558


- added species configurations to test DB

22 lines of code changed in 2 files:

  • UNIT_TESTER/run: TEST_opti_ascii_in.arb (+22 -1), TEST_opti_expected.arb (changed)
westram 2013-08-25 15:09 Rev.: 10482


* Tree IO (patch reintegrates branch 'tree')
- added unit test (!TreeReader, export/import consistency for most export-parameters combinations)
- refactorings: moved more behavior into !TreeReader; deny access to class internals
- improved error messages/warnings
* show error-position in input data when bailing out
* warn about unused data behind tree
* trees < 2 species produce error now
- behavior
* fixed export/import of bootstrap values (expect ':' as separator; avoiding misinterpretation of group names starting with digits)
* auto-name unnamed nodes
* supports bootstrap values specified as percent (e.g. '12.5%')
* no longer interpret {{{''}}} as escape sequence for a single {{{'}}}
* no longer remove leading '_' from leaf-/groupnames (no idea why this was done)
- fixes:
* export+import of tree using double quotes often resulted in leaf-/groupnames enclosed in double-quotes (or more often failed to load completely)
* name of root-node was lost after import.
* better support for single-node subtrees, e.g. '(leafname)'. Nodes were skipped.
* deadlock occurring when tree file was truncated somewhere in the middle.
* leaks stuffed

0 lines of code changed in 1 file:

  • UNIT_TESTER/run: corrupted.tree (del)
westram 2013-07-16 13:23 Rev.: 10282


* added unit test reading corrupted tree file
- checks for proper failure
- failed till [10278]; succeeds now

72 lines of code changed in 1 file:

  • UNIT_TESTER/run: corrupted.tree (new 72)
westram 2013-07-11 17:13 Rev.: 10269


* added a unit test for genome file importer (currently disabled because it segfaults)
- test uses flatfile attached to #335
- expected test result has been generated with [7813] where importer still worked

953 lines of code changed in 2 files:

  • UNIT_TESTER/run: AB735678.txt (new 509), AB735678_expected.arb (new 444)
westram 2013-04-04 11:20 Rev.: 9804


- added unit-test for GB_optimize

1378 lines of code changed in 2 files:

  • UNIT_TESTER/run: TEST_opti_ascii_in.arb (new 1378), TEST_opti_expected.arb (new)
westram 2012-09-27 14:02 Rev.: 8962


* added auto-update-code for normal ptserver
* inserted '...' behind 'GUUUGAUCAAGUCGAGCGGU' in ptserver-test-source-DB
- probe has exactly two occurrances in the middle of the sequence data
- updated test-results for changed data
* ran TEST_SLOW_find_unmatched_probes to check for further index-errors
- no additional errors caused
- i.e. index-errors seem to occur only on 3'-end

4 lines of code changed in 3 files:

  • UNIT_TESTER/run: TEST_pt.arb.pt.expected (changed), TEST_pt_cleaned_expected.arb (+2 -2), TEST_pt_src.arb (+2 -2)
westram 2012-09-13 15:32 Rev.: 8877


* added unit-tests for sequence compression (by master-sequences)
- shows input-restrictions of g_b_put_number2

0 lines of code changed in 1 file:

  • UNIT_TESTER/run: TEST_nuc_seqcompr_exp.arb (new)

(18 more)

Generated by StatSVN 0.7.0